Ксенон приора в задний ход: Ксенон в фонари заднего хода: все что нужно знать

Содержание

Ксенон в фонари заднего хода: все что нужно знать

Ксенон, как самое качественное, яркое и стильное освещение для транспортных средств уже давно эксплуатируется на многих автомобилях. Некоторых водителей интересует вопрос о законности установки ксенона для фонарей заднего хода, о чем мы с вами и поговорим в данной статье. Мы развеем самые «ТОПовые» мифы данного освещения и расскажем вам о том, можно ли ставить ксенон для задних фонарей в автомобилях.

Популярность ксенона в автомобилях

С появлением такого почти идеального по качеству и яркого типа света для транспортных средств его установка стала даже модной. На сегодняшнее время, практически каждый водитель оборудует автомобили таким типом освещения, что является верным решением.

Благодаря ксенону обеспечивается лучшая освещенность дорожного полотна, а, следовательно, и повышается видимость, безопасность для водителей. Ксенон ярко освещает не только дорогу перед автомобилем, но и обочину, а также при его использовании в дневное время машина становится намного ярче и выразительней для окружающих.

Недавно модно стало и использовать ксенон для оснащения фонарей, предназначенных обеспечивать яркий задних ход водителю. Для этого используются самые стандартные, маломощные ксеноновые лампочки.

Мифы и законность установки ксенона для фонарей заднего хода

Существует множество мифов, которые придумывают водители, касательно монтажа ксенона в задние фары. Мы расскажем вам о трех самых интересных и ярких и попробуем их развеять. На их основе расскажем и про законность и практичность монтажа ксенонового оборудования для фонарей заднего хода.

Миф 1: ксеноновые лампы сильно нагреваются, что может расплавить пластиковые фары или же проводку.

Во-первых, для того, чтобы поставить ксенон для заднего хода автомобиля существуют специальные комплекты, например производством Sho-me. Они отличаются небольшими размерами, что лампы, что блоки, а также обладают меньшей мощностью в 35 Вт, по сравнению со стандартными галогеновыми лампами.

Во-вторых, фонари заднего хода используются не постоянно, а только в течении от 5 секунд до 3-х минут. За это время, даже галогеновая лампа не сможет нагреться настолько, чтобы расплавить пластиковые фары или же повредить проводку.

В-третьих, ксеноновые источники света отличаются тем, что их температура нагрева снижена до минимальной отметки по сравнению с тем же галогеном. При работе, ксеноновые лампы выдают только свет, а не тепло, в ту же очередь в галогене больше 60% уходит на выдачу тепла, а не света.

Миф 2: установка ксенона для заднего хода – противопоказана

Если устанавливаются специальные ксеноновые комплекты, назначение которых – это использование в фонарях для заднего хода автомобилей, то противозаконного здесь ничего нет. Стоит отметить, что для такого автомобильного освещения лампы ставятся с той же мощностью, если не менее, что и прежние, а цветовой спектр тоже практически идентичен.

Фонари светят белым светом и используются в случаях парковки, для освещения препятствий позади автомобиля, что не ослепляет водителей сзади вас. То есть, белоснежное свечение фар заднего хода никоем образом не перечит правилам безопасности на дороге.

Миф 3: ксенон очень дорого и не практично

На сегодняшнее время ксенон уже не является чем-то из области фантастики. Изначально такое освещение стоило очень дорого, а поэтому его могли себе позволить исключительно состоятельные люди. Сейчас же, выпускаются комплекты, которые могут приобрести себе люди из разных слоев населения.

В плане практичности здесь тоже есть свои нюансы. Ксенон очень практичен, поскольку он обеспечивает не только качественное освещение, но и служит намного дольше, чем галогеновое освещение.

Сделаем выводы

Таким образом отметим, что не существует специального правила, которое запрещает производить установку ксенона в фонари заднего хода. Вы можете улучшить и модернизировать свой автомобиль, приобретая качественные комплекты ксенона, специально для этих целей. С белоснежным светом ксенона вы получите насыщенное, яркое и качественное освещение дорожного полотна, позволяющее произвести безопасную парковку или же задний ход.

Page not found – автомануал заказ автокниг с доставкой в любую точку мира

НАШИ ПАРТНЕРЫ:

Любой современный легковой или грузовой автомобиль можно обслуживать и ремонтировать самостоятельно, в обычном гараже. Все что для этого потребуется – набор инструмента и заводское руководство по ремонту с подробным (пошаговым) описанием выполнения операций. Такое руководство должно содержать типы применяемых эксплуатационных жидкостей, масел и смазок, а самое главное – моменты затяжки всех резьбовых соединений деталей узлов и агрегатов автомобиля. Итальянские автомобили – Fiat (Фиат) Alfa Romeo (Альфа Ромео) Lancia (Лянча) Ferrari (Феррари) Mazerati (Мазерати) имеют свои конструктивные особенности. Также в особую группу можно выделить все французские машины – Peugout (Пежо), Renault (Рено) и Citroen (Ситроен). Немецкие машины сложные. Особенно это относится к Mercedes Benz (Мерседес Бенц), BMW (БМВ), Audi (Ауди) и Porsche (Порш), в чуть меньшей – к Volkswagen (Фольксваген) и Opel (Опель). Следующую большую группу, обособленную по конструктивным признакам составляют американские производители- Chrysler, Jeep, Plymouth, Dodge, Eagle, Chevrolet, GMC, Cadillac, Pontiac, Oldsmobile, Ford, Mercury, Lincoln. Из Корейских фирм следует отметить Hyundai/Kia, GM-DAT (Daewoo), SsangYong.

Совсем недавно японские машины отличались относительно низкой первоначальной стоимостью и доступными ценами на запасные части, но в последнее время они догнали по этим показателям престижные европейские марки. Причем это относится практически в одинаковой степени ко всем маркам автомобилей из страны восходящего солнца – Toyota (Тойота), Mitsubishi (Мицубиси), Subaru (Субару), Isuzu (Исудзу), Honda (Хонда), Mazda (Мазда или как говорили раньше Мацуда), Suzuki (Сузуки), Daihatsu (Дайхатсу), Nissan (Ниссан). Ну, а машины, выпущенные под японо-американскими брендами Lexus (Лексус), Scion (Сцион), Infinity (Инфинити), Acura (Акура) с самого начала были недешевыми.

 

Отечественные автомобили также сильно изменились с введением норм евро-3. лада калина, лада приора и даже лада нива 4х4 теперь значительно сложнее в обслуживании и ремонте.

что делать если машина не заводится, как зарядить аккумулятор, как завести машину в мороз. ответы на эти вопросы можно найти на страницах сайта и книг. представленных здесь же

Автомануал – от англ. manual – руководство. Пособие по ремонту автомобиля или мотоцикла. различают заводские руководства и книги , выпущенные специализированными автомобильными издательствами.

Cайт Автомануал не несет никакой ответственности за возможные повреждения техники или несчастные случаи, связанные с использованием размещенной информации.

Ксенон MTF (задний ход) лампа 12в, T20/W21W 5K

Компания МТФ Лайт долгое время занималась изучением проблем, связных с перспективой использования ксенонового оборудования и тюнингом. Одним из самых перспективных направлений в этой сфере была идея установки ксенона в фонари заднего хода. Никто не станет отрицать тот факт, что у нас немало любителей затонировать машину, у которых после тонировки автомобиля в темное время суток появляется проблема при парковке. Казалось бы, что парковочные датчики  или камера заднего вида – вот решение проблемы, однако, даже при наличии парковочных датчиков и (или) камеры в темное время суток и без должного освещения Вы все равно не увидите, куда Вы едете. Для решения этой проблемы мы разработали ксенон мощностью 25W.

Причины для установки маломощного ксенона в фонарь заднего хода:

 
1. Лампа накаливания 21W нагревается приблизительно до 100°C , и фары рассчитаны на эти температуры. 25W ксеноновая лампа нагревается до 145°C, но площадь поверхности лампы в 3 раза меньше, чем лампы накаливания, –  и в итоге температура вокруг 50°C. Это гораздо ниже, а значит, снижается риск оплавления корпуса фонаря.
 
2. Для камеры и для парковочных датчиков надо по всей машине протягивать провода разбирая салон, а/м и дополнительное питание. 25W ксенон не нуждается в дополнительном питаний и протягиванием проводов. Он работает со штатной проводки и мощность рассчитанное для ламп накаливания в полнее хватает.
 
3. Можно, конечно же, поставить и ксенон 35W. Но он нагревается почти до 400°C и при запуске потребляет до 8А ,что не позволительно для штатной проводки автомобиля и, что, немаловажно, может привести к возгоранию электропроводки и блоков управления. Также не стоит забывать о проблемах, которые возникнут при установке: лампа 35W длиннее штатной лампы накаливания, и существует высокая вероятность того, что лампа не поместится в фонаре или приведет к оплавлению фонаря.
 
4. И последнее, но не менее важное, особенно в наше время: стоимость установки комплекта ксенона 21W значительно ниже стоимости работ по установке камеры заднего вида или парковочных датчиков.

цветовая температура: 5000к
цоколь T20/W21W

Лада Приора — замена ламп заднего фонаря — журнал За рулем

Заменить лампы в задних фонарях автомобиля Лада Приора вы сможете самостоятельно – для этого достаточно воспользоваться нашим пошаговым руководством.

ф2

Расположение ламп в заднем фонаре автомобилей Лада Приора выпуска с 2013 года с кузовами седан и хэтчбек: 1 — лампа указателя поворота; 2 — лампа противотуманного света; 3 — лампа света заднего хода; 4 — блок светодиодов, отвечающий за габаритный свет и сигнал торможения

Расположение ламп в заднем фонаре автомобилей Лада Приора выпуска с 2013 года с кузовами седан и хэтчбек: 1 — лампа указателя поворота; 2 — лампа противотуманного света; 3 — лампа света заднего хода; 4 — блок светодиодов, отвечающий за габаритный свет и сигнал торможения

Расположение ламп в заднем фонаре автомобилей Лада Приора выпуска с 2013 года с кузовами седан и хэтчбек: 1 — лампа указателя поворота; 2 — лампа противотуманного света; 3 — лампа света заднего хода; 4 — блок светодиодов, отвечающий за габаритный свет и сигнал торможения

ф1

Расположение ламп в заднем фонаре автомобиля Лада Приора выпуска до 2013 года с кузовом седан: 1 — лампа света заднего хода; 2 — лампа габаритного света и сигнала торможения; 3 — лампа сигнала указателя поворота; 4 — лампа противотуманного света

Расположение ламп в заднем фонаре автомобиля Лада Приора выпуска до 2013 года с кузовом седан: 1 — лампа света заднего хода; 2 — лампа габаритного света и сигнала торможения; 3 — лампа сигнала указателя поворота; 4 — лампа противотуманного света

Расположение ламп в заднем фонаре автомобиля Лада Приора выпуска до 2013 года с кузовом седан: 1 — лампа света заднего хода; 2 — лампа габаритного света и сигнала торможения; 3 — лампа сигнала указателя поворота; 4 — лампа противотуманного света

Работа по замене ламп показана на левом фонаре автомобиля Лада Приора выпуска с 2013 года. На правом фонаре операции выполняем аналогично.

Для замены ламп в заднем фонаре достаточно отвернуть гайки его крепления и отвести фонарь от кузова, не отсоединяя колодку проводов фонаря от колодки заднего жгута проводов.

DS4

Внутри багажника отгибаем клапан обивки, закрывающий две гайки крепления фонаря.

Внутри багажника отгибаем клапан обивки, закрывающий две гайки крепления фонаря.

Внутри багажника отгибаем клапан обивки, закрывающий две гайки крепления фонаря.

DS4 4

Отворачиваем две пластмассовые гайки крепления фонаря.

Отворачиваем две пластмассовые гайки крепления фонаря.

Отворачиваем две пластмассовые гайки крепления фонаря.

DS4 45

Отгибаем другой клапан обивки багажника и отворачиваем третью гайку крепления фонаря.

Отгибаем другой клапан обивки багажника и отворачиваем третью гайку крепления фонаря.

Отгибаем другой клапан обивки багажника и отворачиваем третью гайку крепления фонаря.

DS4 455

Отводим фонарь от кузова.

Отводим фонарь от кузова.

Отводим фонарь от кузова.

DS4 4556

Повернув против часовой стрелки патрон лампы указателя поворота (для наглядности показано на снятом фонаре)…

Повернув против часовой стрелки патрон лампы указателя поворота (для наглядности показано на снятом фонаре)…

Повернув против часовой стрелки патрон лампы указателя поворота (для наглядности показано на снятом фонаре)…

DS4 455655

…вынимаем патрон с лампой из корпуса фонаря.

…вынимаем патрон с лампой из корпуса фонаря.

…вынимаем патрон с лампой из корпуса фонаря.

DS4 4556555

Нажав на лампу, поворачиваем ее до упора против часовой стрелки и вынимаем лампу из патрона.

Нажав на лампу, поворачиваем ее до упора против часовой стрелки и вынимаем лампу из патрона.

Нажав на лампу, поворачиваем ее до упора против часовой стрелки и вынимаем лампу из патрона.

Новую лампу PY21W устанавливаем в обратной последовательности. При этом два выступа, расположенных несимметрично относительно оси лампы, должны войти в соответствующие пазы патрона.

Операции по замене остальных ламп выполняем аналогично. К каждому патрону лампы помимо «массового» провода черного цвета подведены другие провода, имеющие различные цвета. Чтобы не перепутать патроны ламп при их установке, на корпусе фонаря указаны соответствующие цвета проводов.

DS4 45565557

Например, на корпусе фонаря рядом с гнездом для патрона лампы имеется надпись «оранжевый», соответствующая оранжевому проводу патрона лампы.

Например, на корпусе фонаря рядом с гнездом для патрона лампы имеется надпись «оранжевый», соответствующая оранжевому проводу патрона лампы.

Например, на корпусе фонаря рядом с гнездом для патрона лампы имеется надпись «оранжевый», соответствующая оранжевому проводу патрона лампы.

После замены лампы установку заднего фонаря производим в обратном порядке.

Ксенон (Xe) – химические свойства, воздействие на здоровье и окружающую среду


Ксенон

Ксенон – это редкий газ без запаха, цвета и вкуса, химически инертный. Он считался полностью инертным, пока в 1962 году Нил Бартлетт не сообщил о синтезе гаксафтороплатината ксенона. В газонаполненной трубке ксенон излучает синий свет при возбуждении электрическим разрядом.

Приложения

Ксенон имеет относительно небольшое коммерческое применение.Он используется в фотовспышках, стробоскопических лампах, высокоинтенсивных дуговых лампах для проецирования кинофильмов и дуговых лампах высокого давления для получения ультрафиолетового света (имитаторы солнечного света). Другое применение – в качестве общего анестетика. На некоторых автомобилях используются ксеноновые «синие» фары и противотуманные фары, которые, как говорят, менее утомительны для глаз. Они освещают дорожные знаки и разметку лучше, чем обычные фонари.

Ксенон в окружающей среде

Ксенон – это следовой газ в атмосфере Земли, содержание которого составляет 1: 20 миллионов.Единственный коммерческий источник ксенона – промышленные установки с жидким воздухом. Мировое производство составляет менее 1 тонны в год, хотя запасы ксенона в атмосфере составляют 2 миллиарда тонн.

Воздействие ксенона на здоровье

Вдыхание: Этот газ инертен и классифицируется как простое удушающее средство. Вдыхание чрезмерных концентраций может вызвать головокружение, тошноту, рвоту, потерю сознания и смерть. Смерть может наступить в результате ошибок в суждениях, замешательства или потери сознания, которые препятствуют самоспасанию.При низких концентрациях кислорода потеря сознания и смерть могут наступить в считанные секунды без предупреждения.

Эффект простых удушающих газов пропорционален степени, в которой они уменьшают количество (парциальное давление) кислорода в вдыхаемом воздухе. Кислород может быть уменьшен до 75% от его нормального процентного содержания в воздухе, прежде чем появятся заметные симптомы. Это, в свою очередь, требует наличия простого удушающего агента в концентрации 33% в смеси воздуха и газа. Когда простое удушающее средство достигает концентрации 50%, могут появиться выраженные симптомы.Концентрация 75% смертельна за считанные минуты. Симптомы: Первые симптомы простого удушья – учащенное дыхание и голод. Снижена умственная активность и нарушена мышечная координация. Позднее суждение становится ошибочным, и все ощущения подавляются. Часто в результате возникает эмоциональная нестабильность и быстрое утомление. По мере прогрессирования асфиксии могут возникать тошнота и рвота, прострация и потеря сознания и, наконец, судороги, глубокая кома и смерть.

Этот агент не считается канцерогеном.

Воздействие ксенона на окружающую среду

Ксенон – редкий атмосферный газ, поэтому не токсичен и химически инертен. Чрезвычайно низкая температура (-244 o C) приведет к замораживанию организмов при контакте, но долгосрочных экологических последствий не ожидается.

Рекомендации по утилизации: Когда возникает необходимость в утилизации, медленно выпускайте газ в хорошо вентилируемое место на открытом воздухе, удаленное от рабочих зон персонала и воздухозаборников здания.Не утилизируйте остаточный газ в баллонах со сжатым газом. Верните баллоны поставщику с остаточным давлением, клапан баллона плотно закрыт. Обратите внимание, что государственные и местные требования по утилизации отходов могут быть более строгими или иным образом отличаться от федеральных правил. Проконсультируйтесь с государственными и местными правилами относительно правильной утилизации этого материала.


Вернуться к периодической таблице элементов

Ксенон и изофлуран снижают ремоделирование левого желудочка у крыс после инфаркта миокарда | Анестезиология

После индукции анестезии внутрибрюшинной инъекцией 200 мг / кг s-кетамина (Pfizer, Берлин, Германия) была установлена ​​электрокардиограмма в трех отведениях и первое эхокардиографическое исследование с датчиком 10 МГц (Vivid I, GE, Solingen Германия).Животных перорально интубировали и вентилировали 30% кислорода и 70% азота в режиме контролируемого давления с положительным давлением в конце выдоха 5 см H 2 O с использованием аппарата для анестезии замкнутого цикла для контроля содержания углекислого газа в конце выдоха. концентрация (Physioflex

® , Draeger, Любек, Германия). Левую яремную вену катетеризовали канюлей 22G (Leader Flex, Vygon, Aachen, Германия) для восполнения жидкости (10 мл · кг -1 · ч -1 раствор Рингера) и забора крови.Глубину анестезии оценивали каждые 30 минут с помощью защемления хвоста. В случае движения конечностей или увеличения частоты сердечных сокращений (ЧСС) внутрибрюшинно вводили 50 мг / кг s-кетамина. Кровяное давление контролировали с помощью катетера давления 1,4F (SPR-671, Millar Instruments, Хьюстон, Техас) через правую бедренную артерию. Животных помещали на грелку с обратной связью для поддержания температуры тела на уровне 37 ° C (контроллер TCAT-2; Physitemp, Клифтон, Нью-Джерси). После левой боковой торакотомии между четвертым и пятым ребром, вокруг левой передней нисходящей коронарной артерии наложили лигатуру.Впоследствии животные были случайным образом разделены на четыре группы с использованием системы запечатанных конвертов (см. Рис. 1). Идентификационные номера, предоставленные животноводческим комплексом, использовались в качестве псевдонимов, чтобы ослепить эксперта для будущих исследований и анализа. Группы лечения получали 0,43 минимальной альвеолярной концентрации (MAC) анестезирующих газов, соответственно, 0,6 об.% Изофлурана (Forene, Abbott, Висбаден, Германия) или 70 об.% Ксенона (LENOXe, Air Liquide Medical GmbH, Дюссельдорф, Германия), как заменитель азота.Контрольная и фиктивная группы получали дополнительное количество s-кетамина для поддержания анестезии. Через 1 час левая передняя нисходящая коронарная артерия была окклюзирована на 1 час, за исключением фиктивной группы. Через 2 часа реперфузии раны послойно закрыли и анестезию прекратили. Вторую эхокардиограмму выполняли после экстубации животных и достижения достаточного спонтанного дыхания. Для послеоперационного обезболивания раны инфильтрировали 1 мл 0,5% ропивакаина (Astra Zeneca, Wedel, Германия).Метамизол (Ratiopharm, Ulm, Германия) вводили внутрибрюшинно (20 мг / кг) и добавляли в водопроводную воду (10 мг / мл / кг) в течение 3 дней. Крыс переводили в теплую изолирующую камеру (Vetario S10 Intensive Care Unit, Brinsea, Sandford, United Kingdom) для выздоровления.

Рис. 1.

Протокол эксперимента: животные были случайным образом разделены на четыре группы исследования: контрольная (s-кетамин), изофлуран, ксенон и имитация.После обработки в день 0 (первый OP) крыс подвергали 60-минутной ишемии миокарда и 120-минутной реперфузии. После наблюдения в течение 28 дней, измерения проводимости катетера были выполнены после дополнительных инструментов (второй OP). Стрелки и отмечают моменты времени измерения (T0 – T4). Эхокардиограммы (эхо) были получены в TO, T3 и T4, а петли давления и объема (PV) в T4.

Рис. 1.

Протокол эксперимента: животные были случайным образом разделены на четыре исследуемые группы: контроль (s-кетамин), изофлуран, ксенон и имитация.После обработки в день 0 (первый OP) крыс подвергали 60-минутной ишемии миокарда и 120-минутной реперфузии. После наблюдения в течение 28 дней, измерения проводимости катетера были выполнены после дополнительных инструментов (второй OP). Стрелки и отмечают моменты времени измерения (T0 – T4). Эхокардиограммы (эхо) были получены в TO, T3 и T4, а петли давления и объема (PV) в T4.

В период с 1 по 28 день ни одно животное не погибло.Прирост массы тела и линейный рост большеберцовой кости существенно не различались между группами (среднее увеличение, соответственно, 68 ± 4 г и 2,1 ± 0,1 мм). По сравнению с моментом времени T3, на 28 день (T4) sAP и CO были значительно увеличены во всех группах и, таким образом, вернулись к исходным значениям. ЧСС осталась без изменений. RS global и RS ant , напротив, не изменились на 28 день по сравнению с T3 и остаются сниженными по сравнению с исходным уровнем (T0) во всех группах инфаркта. На 28 день RS ant был значительно выше только в фиктивной группе (таблица 2).Общее увеличение конечного диастолического диаметра левого желудочка могло наблюдаться со значительно более низкими значениями в фиктивной группе (таблица 2).

Типичные примеры петель давления и объема на рисунке 3A иллюстрируют различия в глобальной сердечной функции между группами через 4 недели после ишемии. ANOVA показал значительные различия между группами, EDV, EF и S PRSW (рис. 3, B – D). Post hoc анализ показал, что по сравнению с контрольной группой EDV была значительно ниже после анестезии ксеноном и в фиктивной группе.EF и S PRSW были значительно выше только в ксеноновой и имитационной группах.

Рис. 3.

Глобальная сердечная функция (T4): влияние анестезии через 28 дней на примерные петли объема давления (PV) ( A ), конечный диастолический объем (EDV; B ), фракцию выброса (EF ; C ), а также крутизну отношения рабочего хода с возможностью набора предварительной нагрузки (S PRSW ; D ), измеренного с помощью катетера проводимости (значения являются средними ± SD, ** P <0.01 *** P <0,001 по сравнению с контролем из дисперсионного анализа и апостериорного анализа ).

Рис. 3.

Глобальная сердечная функция (T4): влияние анестезии через 28 дней на примерные петли объема давления (PV) ( A ), конечный диастолический объем (EDV; B ), фракцию выброса ( EF; C ), а также крутизну отношения рабочего хода с возможностью набора предварительной нагрузки (S PRSW ; D ), измеренного с помощью катетера проводимости (значения являются средними ± SD, ** P <0.01 *** P <0,001 по сравнению с контролем из дисперсионного анализа и апостериорного анализа ).

В соответствии с этими различиями, нормализованный вес сердца (относительно длины большеберцовой кости) был самым высоким в контрольной группе (рис. 4A). Значения, измеренные у животных, получавших изофлуран, и в фиктивной группе были значительно ниже, чем у контрольной группы. По сравнению с контрольной группой рассчитанный индекс ремоделирования был значительно ниже в группе ксенона и имитационно оперированных животных (рис.4Б). Толщина задней стенки достоверно различалась только между контрольной и фиктивной группами (рис. 4С). Никаких различий между группами по площади поперечного сечения кардиомиоцитов в удаленном миокарде не обнаружено (рис. 4D).

Рис. 4.

Показатели гипертрофии миокарда (28 день): влияние анестезии через 28 дней на массу сердца, нормированную на длину большеберцовой кости ( A ), индекс ремоделирования ( B ), толщину задней стенки ( C ) и площади поперечного сечения кардиомиоцитов ( D ) (значения являются средними ± SD, * P <0.05 ** P <0,01 ( по сравнению с контролем из ANOVA и апостериорным тестом ).

Рис. 4.

Показатели гипертрофии миокарда (28 день): влияние анестезии через 28 дней на массу сердца, нормированную на длину большеберцовой кости ( A ), индекс ремоделирования ( B ), толщину задней стенки ( C ) и площади поперечного сечения кардиомиоцитов ( D ) (значения являются средними ± SD, * P <0,05 ** P <0,01 vs. контроль из ANOVA и апостериорный тест ).

Размер инфаркта составлял приблизительно 50% от начальной гипо- / акинетической области, без различий между тремя группами инфаркта (рис. 5A). Никакого влияния на степень фиброза и плотность капилляров в удаленной области не наблюдалось (рис. 5, B и C). Экспрессия каспазы-3 была снижена после анестезии изофлураном или ксеноном и достигла уровней, сопоставимых с таковой у имитационных оперированных животных (рис.5D).

Рис. 5.

Показатели ремоделирования миокарда (Т4): влияние анестезии через 28 дней на размер инфаркта ( A ), степень фиброза ( B ), плотность капилляров ( C ) и относительное количество (RQ) экспрессии каспазы-3 ( D ) в удаленной области (значения являются средними ± SD, * P <0,05 ** P <0,01 *** P <0.001 по сравнению с контролем из дисперсионного анализа и апостериорного теста ).

Рис. 5.

Показатели ремоделирования миокарда (T4): влияние анестезии через 28 дней на размер инфаркта ( A ), степень фиброза ( B ), плотность капилляров ( C ) и относительную количество (RQ) экспрессии каспазы-3 ( D ) в удаленной области (значения являются средними ± SD, * P <0,05 ** P <0,01 *** P <0.001 по сравнению с контролем из дисперсионного анализа и апостериорного теста ).

Соотношение α, – и β-MHC было снижено в контрольной и изофлурановой группах, тогда как оно оставалось почти нормальным в группе ксенона (рис. 6А). Однако эти эффекты просто не достигли статистической значимости ( P = 0,054). Анестезиологическое обеспечение повлияло на экспрессию α-скелетного актина , с самыми высокими значениями, зарегистрированными в контрольной группе (рис.6Б). Наибольшие значения экспрессии периостина наблюдались в контрольной группе и группе изофлурана, но между группами можно было продемонстрировать значительные различия (рис. 6С). Экспрессия сарко / эндоплазматического ретикулума Ca 2+ -АТФаза , по-видимому, была снижена в контрольной группе, но этот эффект не достиг уровня значимости (фиг. 6D).

Рис.6.

Экспрессия гена (28 день): влияние анестезии через 28 дней на соотношение α – и β -MHC ( A ) и относительное количество (RQ) α-скелетного (scel ) актин ( B ), периостин ( C ) и сарко / эндоплазматический ретикулум Ca 2+ -ATPase (SERCA2) ( D ) в удаленной области (значения: означает ± стандартное отклонение, ** P <0,01 ( по сравнению с контролем из ANOVA и апостериорным тестом ).

Рис. 6.

Экспрессия гена (28 день): влияние анестезии через 28 дней на соотношение α – и β -MHC ( A ) и относительное количество (RQ) α- скелетный (скел) актин ( B ), периостин ( C ) и сарко / эндоплазматический ретикулум Ca 2+ -ATPase (SERCA2) ( D ) в удаленном площадь (значения – средние ± стандартное отклонение, ** P <0,01 vs. контроль из ANOVA и апостериорный тест ).

Это исследование впервые продемонстрировало различные функциональные и структурные эффекты изофлурановой и ксеноновой анестезии на постинфарктное ремоделирование сердца. В настоящей модели 60-минутная преходящая ишемия миокарда вызвала значительный инфаркт миокарда, который через 4 недели привел к прогрессирующему неблагоприятному ремоделированию с изменениями структуры, формы и функции.Как и ожидалось, изофлуран и ксенон уменьшали исходное повреждение миокарда и гемодинамические нарушения, тогда как степень последующего неблагоприятного ремоделирования была различной через 4 недели. Снижение индекса ремоделирования, нарушение сердечной функции и активация генов плода были затруднены в большей степени у животных, анестезированных ксеноном, чем изофлураном, при введенных концентрациях.

До сих пор были описаны только острые эффекты изофлурана и ксенона на ИК-повреждение.Сравнительные исследования показали, что эффекты начального повреждения миокарда уменьшаются в той же степени после кондиционирования изофлураном или ксеноном. 14,18 Хотя ксенон менее кардиодепрессант, чем изофлуран в нормальном сердце, 19 различия в гемодинамических ответах на острую ишемию или увеличение постнагрузки являются результатом различных воздействий на сосудистую систему, а не сократимость миокарда. 20,21 Эти наблюдения могут быть подтверждены текущим исследованием, особенно снижением нарушения регионарной сократимости (RS и ).Опять же, никаких различий во влиянии изофлурана или ксенона на гемодинамику (HR, sAP и CO), общую функцию сердца (RS global ) или уменьшение повреждения миокарда (тропонин I) в острой фазе обнаружено не было. . Региональная функция, показанная RS и , казалась лучше после анестезии ксеноном. Хотя это различие исчезло, соответствующие изменения можно было описать через 4 недели после повреждения ИР.

Процессы, участвующие в неблагоприятном ремоделировании сердца после инфаркта миокарда, включают гипертрофию, некроз, апоптоз, фиброз, ангионогенез и сократительную дисфункцию, прежде всего в удаленной области, а также в периинфарктной области, что приводит к прогрессирующей дилатации желудочков и ухудшению функции. 22,23 Постоянная окклюзия коронарной артерии у крысы привела к увеличению массы сердца на 25%, увеличению объема / диаметра желудочков на 40–50%, истончению задней стенки на 20% и уменьшению на 50–60%. ЭФ через 4 недели. 24–27 Эти результаты согласуются с выводами этого исследования и опубликованными данными после транзиторной ишемии и могут отображать изменения формы (конечный диастолический диаметр левого желудочка, КДО, вес сердца, толщина стенки и индекс ремоделирования) и функции. (EF, S PRSW ). 28–30 В отличие от опубликованных данных, 24,27 не наблюдалось значительного увеличения площади поперечного сечения миоцитов или фиброза, а также снижения плотности капилляров на удаленных участках у нелеченных животных после ИК-травмы. Как и ожидалось, соотношение α / β-MHC снизилось, а экспрессия α-скелетного актина и периостина увеличилась в течение 4 недель после повреждения IR, что указывает на неблагоприятное ремоделирование. 22,31 Подавление сарко / эндоплазматического ретикулума Ca 2+ -ATPase не достигло значительного уровня, 32 , тогда как повышенная регуляция проапоптотического гена c aspase-3 была подтверждена . 33

Различные методы лечения были протестированы на животных моделях для ограничения постинфарктного ремоделирования. Реперфузия в течение 60–120 минут снижает дилатацию желудочков на 20% без уменьшения размера инфаркта. 34 Лечение в течение 4 недель ингибиторами ангиотензинпревращающего фермента, антагонистами β1-рецепторов и β2-агонистами уменьшило массу сердца на 30%, фиброз на 40–50% и дилатацию на 10–20%, и это улучшило EF на 25%. 26,35–37

По сравнению с этими данными, анестезия ксеноном подавляла дилатацию желудочков (EDV, индекс ремоделирования), функциональное ухудшение (EF, S PRSW ) и экспрессию генов плода (β -MHC, периостин ) лучше, чем изофлуран, хотя размер инфаркта и первоначальное повреждение миокарда были сопоставимы. Меньшая масса сердца в сочетании с тонкой стенкой желудочка и большим объемом может указывать на большую потерю кардиомиоцитов после анестезии изофлураном.Напротив, защитные эффекты ксенона превышают действие ингибиторов ангиотензинпревращающего фермента и антагонистов рецептора β1, с КДО на 30% меньше и сохраненным EF 62%, что не отличается от фиктивных животных, в то время как EF необработанных животных составляло 35 %. Только EF и S PRSW в качестве независимого от нагрузки параметра сократимости смогли продемонстрировать функциональные различия между изофлураном, ксеноном и контрольными группами, в то время как эхокардиографические значения не дали результатов (SR ant , RS global ) через 4 недели после IR травмы. .Хотя сравнительные исследования на крысах между анализом деформации и анализа петли давление-объем отсутствуют, эхокардиограмма должна включать все сегменты левого желудочка для описания сократимости после инфаркта миокарда. 38

Таким образом, эти различия между изофлураном и ксеноном неожиданно показали, что краткосрочная терапия в острой фазе способна предотвратить неблагоприятное ремоделирование сердца, независимо от первоначального уменьшения повреждения миокарда.Однако при введенных концентрациях ксенон превосходит изофлуран в предотвращении ишемического повреждения и способствует долгосрочному восстановлению сократительной функции.

Механизмы могут быть только умозрительными. В то время как транскрипционные изменения изофлурана после пре- или посткондиционирования были описаны подробно, о эффектах ксенона известно меньше 7 . Наблюдались различия в активации сигнальных киназ, способствующих выживанию и смерти.Прекондиционирование опосредовано, среди прочего, активацией митоген-активируемой протеинкиназы, киназы, регулируемой внеклеточными сигналами, и путей Akt1. 39,40 В то время как ксенон и изофлуран активировали фосфатидилинозитид-3-киназу, Akt1, киназу гликоген-синтазы 3, киназу, регулируемую внеклеточным сигналом, и p38α, только изофлуран фосфорилировал N-концевые киназы c-Jun. 41,42 Активация N-концевых киназ c-Jun способствует апоптозу и патологическому расширению желудочков. 43 В отличие от изофлурана, ксенон приводил к перемещению белка теплового шока 27 из цитозольной фракции во фракцию саркомера. 39 Было показано, что это актуально для восстановления сократительной функции после травмы IR. 44–46 Также было продемонстрировано, что фосфорилирование белка теплового шока 27 ослабляет вызванную доксорубицином дилатационную кардиомиопатию. 47 Эти данные требуют дальнейших сравнительных исследований. Незначительные изменения на ранней стадии могут повлиять на вызванное стрессом расширение миокарда без инфаркта (концепция Гроссмана). 48

Поскольку все животные получали значительное количество s-кетамина, а совокупная доза различается между группами, возможные различные взаимодействия с изофлураном и ксеноном могут повлиять на результаты. Сайты связывания s-кетамина описаны на холинергических, адренергических, ионных каналах (кальциевых, натриевых), опиодных и N-метил-d-аспартатных рецепторах даже в сердце. 49 Возникающие в результате прямые или косвенные симпатикомиметические свойства (высвобождение катехоламинов и ингибирование обратного захвата) были противопоставлены прямым отрицательным инотропным и опосредованным N-метил-d-аспартатом рецептором 1 отрицательным хронотропным эффектом. 50 Хотя стимуляция опиода 51 и адренергических рецепторов 52 перед кардиопротекцией, вызванной ишемией, s-кетамин не влияет на ишемическое прекондиционирование 53 или фосфорилирование при ИК-повреждении вовлеченных протеинкиназ. 39 Кроме того, между группами не было обнаружено различий по ЧСС, САП и глубине анестезии, которые могли бы повлиять на ИК-повреждение. Таким образом, релевантное лекарственное взаимодействие между s-кетамином и изофлураном, соответственно, ксеноном, казалось маловероятным.

Примечательно, что с точки зрения состояния анестезии соответствующее значение ПДК 0,6 об.% Изофлурана было сопоставимо у людей и крыс (0,46 против 0,43), но было другим для 70 об.% Ксенона (1,0 против 0,43). . Это предполагает различный механизм действия, зависящий от вида. 54 Хотя видозависимые эффекты анестезирующих газов на глубину анестезии и барорецепторные рефлексы описаны подробно, чувствительность кардиомиоцитов к ним еще не сравнивалась.Однако сравнение МАК было стандартом в исследованиях анестезии и привело к сопоставимым гемодинамическим состояниям, как в текущем исследовании. В то время как степень нейрозащиты с помощью ксенона 54 и изофлурана 55 была дозозависимой, действие изофлурана в диапазоне от 0,25 до 1,75 МАК на миокард оставалось спорным. Уменьшение размера инфаркта миокарда изофлураном, по-видимому, не зависело от концентрации в сердце крысы, 56 , но зависело у собак. 57 Механизм защиты зависел от дозировки, поскольку протеинкиназа Cε фосфорилировалась только при низких концентрациях (0,4 МАК) 56 и на нее дополнительно влиял коронарный кровоток, особенно у животных с предварительно сформированными коронарными коллатералями. 57 Сопоставимые результаты отсутствуют для ксенона, но 20 об.% Ксенона было недостаточно для посткондиционирования в сердце крысы. 58 Таким образом, было бы трудно разделить прямое или косвенное опосредованное действие анестетиков на сердце, и необходимы дальнейшие исследования с различными концентрациями.

Дополнительные ограничения этого исследования включают низкое количество животных в группе и короткий период наблюдения. Воздействие на экспрессию генов и сердечную функцию будет более выражено через 3 месяца. 37,59 Однако, поскольку различия между изофлураном и ксеноном были непредсказуемы, расчет мощности был бы затруднен. К сожалению, оценка гемодинамики и эхокардиограммы проводилась без слепого обзора с момента времени T0 до T3.

В заключение, несмотря на аналогичные острые кардиозащитные свойства, ксенон препятствовал неблагоприятному ремоделированию сердца после ИК-повреждения более эффективно, чем изофлуран, особенно в отношении уменьшения дилатации желудочков и улучшения сердечной функции.

Выражаем особую благодарность Ренате Наденау и Кристиану Беккерсу (технические специалисты отделения анестезиологии университетской больницы Аахена, Аахен, Германия) за их помощь в нашей лаборатории.

Intermittent Exposure to Xenon Protects against Gentamicin-Induced Nephrotoxicity

PLoS One. 2013; 8(5): e64329.

, 1 , 1 , 1 , 1 , 1 , 1 , 2 , 2 and 1 , *

Ping Jia

1 Division of Nephrology, Zhongshan Hospital Fudan University, Shanghai, China,

Jie Teng

1 Division of Nephrology, Zhongshan Hospital Fudan University, Shanghai, China,

Jianzhou Zou

1 Division of Nephrology, Zhongshan Hospital Fudan University, Shanghai, China,

Yi Fang

1 Division of Nephrology, Zhongshan Hospital Fudan University, Shanghai, China,

Suhua Jiang

1 Division of Nephrology, Zhongshan Hospital Fudan University, Shanghai, China,

Xiaofang Yu

1 Division of Nephrology, Zhongshan Hospital Fudan University, Shanghai, China,

Alison J.Кригель

2 Кафедра физиологии Медицинского колледжа Висконсина, Милуоки, Висконсин, Соединенные Штаты Америки,

Минюй Лян

2 Кафедра физиологии Медицинского колледжа Висконсина, Милуоки, Висконсин, Соединенные Штаты Америки,

Сяоцян Дин

1 Отделение нефрологии, Госпиталь Чжуншань, Университет Фудань, Шанхай, Китай,

Эммануэль А. Бурдманн, редактор

1 Отделение нефрологии, Госпиталь Чжуншань, Университет Фудань, Шанхай, Китай,

2 Кафедра физиологии Медицинского колледжа Висконсина, Милуоки, Висконсин, Соединенные Штаты Америки,

Медицинский факультет Университета Сан-Паулу, Бразилия,

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Задумал и спроектировал эксперименты: PJ ML XD. Проведены эксперименты: PJ JT JZ YF SJ XY XD. Проанализированы данные: PJ AJK XD ML. Предоставленные реагенты / материалы / инструменты для анализа: PJ.JT JZ YF AJK. Написал статью: PJ XD.

Поступила 3 ​​февраля 2013 г .; Принята в 2013 г. 12 апреля.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего указания автора и источника.

Эта статья цитируется в других статьях в PMC.
Дополнительные материалы
Рисунок S1: Протоколы экспериментов 1 (A) и 2 (B). НС, физиологический раствор; Хе, ксенон; N 2 , азот; гент, гентамицин; N 2 + г, азот + гентамицин; Хе + г, ксенон + гентамицин; РФ, функция почек; TUNEL, мечение ник-концов dUTP, опосредованное терминальной дезоксинуклеотидилтрансферазой; ИГХ, иммуногистохимия; q-ПЦР, количественная полимеразная цепная реакция; WB, вестерн-блоттинг.

(TIF)

GUID: 9723F9F6-79A9-419F-BD06-D0779B876CFD

Abstract

Аминогликозидные антибиотики, особенно гентамицин, широко используются для лечения грамотрицательных инфекций из-за их низкой стоимости. Тем не менее использование гентамицина ограничено его основным побочным эффектом – нефротоксичностью. Ксенон (Xe) оказывал существенное органопротекторное действие при остром повреждении мозга и сердца и защищал от ишемического реперфузионного повреждения почек. В этом исследовании мы изучали, может ли ксенон защитить от нефротоксичности, вызванной гентамицином.Крыс-самцов Wistar периодически подвергали воздействию 70% ксенона или 70% азота (N 2 ), сбалансированного с 30% кислородом, до и во время введения гентамицина в дозе 100 мг / кг в течение 7 дней для моделирования повреждения почек, вызванного гентамицином. Мы наблюдали, что периодическое воздействие Xe обеспечивало морфологическую и функциональную защиту почек, которая характеризовалась ослаблением повреждения почечных канальцев, апоптоза и окислительного стресса, но не уменьшением воспаления. Мы также обнаружили, что предварительная обработка Xe активировала индуцируемый гипоксией фактор 2α (HIF-2α) и его последующий эффекторный фактор роста эндотелия сосудов, но не HIF-1α.Что касается трех пролилгидроксилаз HIF, предварительная обработка Xe активировала протеин-2, содержащий домен пролилгидроксилазы (PHD2), подавляла PHD1 и не влияла на PHD3 в почках крыс. Предварительная обработка Xe также увеличивала экспрессию miR-21, микроРНК, которая, как известно, обладает антиапоптотическим действием. Эти результаты подтверждают ренопротектор Xe против нефротоксичности, вызванной гентамицином.

Введение

Лекарственная нефротоксичность – одна из наиболее частых причин острого повреждения почек (ОПП) [1], характеризующаяся повышением уровня креатинина и мочевины в сыворотке крови и легким или тяжелым поражением проксимальных канальцев почек.Это происходит у 10–25% пациентов, получавших терапевтические дозы аминогликозидов [2], особенно гентамицина.

Все больше данных указывает на то, что механизмы, связанные с нефротоксичностью, вызванной гентамицином, многогранны [2], [3]. Фенотипические изменения, которые способствуют острому повреждению почек, включают гемодинамические изменения [4], некроз и апоптоз эпителиальных клеток почечных канальцев [5], [6], воспалительную реакцию [7], [8] и окислительный стресс [9], несмотря на то, что Несмотря на нежелательные токсические эффекты гентамицина, он все еще широко используется против инфекций грамположительными и грамотрицательными аэробными бактериями из-за его превосходного антибактериального профиля и эффективности [10], [11].Учитывая в значительной степени неэффективные терапевтические стратегии для предотвращения случаев нефротоксичности, вызванной гентамицином, в клинике, явно необходима разработка новых и эффективных терапевтических вмешательств.

Благородный газ ксенон (Xe) используется в качестве анестетика более 50 лет. Xe обладает многими свойствами идеального анестетика, включая небольшой коэффициент распределения газов в крови [12] и низкую токсичность. Более того, Xe не является загрязнителем окружающей среды [13] и не вызывает значительных изменений гемодинамики и сердечно-сосудистой системы [14], [15].Интересно, что многие исследования показали, что Xe также оказывает существенное органопротекторное действие при остром повреждении мозга [16], [17], сердца [18] – [20] и почек [21], независимо от анестезии.

Точные механизмы, лежащие в основе защитных эффектов Xe, еще предстоит выяснить. Ma et al. [21] продемонстрировали, что прекондиционирование Xe защищает от ишемического реперфузионного повреждения почек (IRI) у мышей за счет активации мишени рапамицина у млекопитающих (mTOR) и последующего повышения экспрессии HIF-1α и его нижестоящих эффекторов.Здесь мы продемонстрировали, что периодическое воздействие Xe защищает крыс от функциональных и морфологических показателей нефротоксичности, вызванной гентамицином. Ренопретекция, обеспечиваемая Xe, характеризовалась ослаблением повреждения канальцев, апоптоза и окислительного стресса, но не воспалением. Возможные механизмы этой защиты включают повышающую регуляцию miR-21, индуцируемого гипоксией фактора 2α (HIF-2α) и его нижестоящего эффекторного фактора роста эндотелия сосудов (VEGF).

Материалы и методы

Животные

Эксперименты проводились на крысах-самцах Wistar (Центр животных Фуданского университета, Шанхай, Китай) весом 200–230 г, помещенных в клетки с контролируемой температурой и влажностью (20 ° C и 60 ° C). % влажности) со свободным доступом к воде и корму для грызунов, полученным в Центре животных Университета Фудань, и 12-часовым циклом свет / темнота.Все протоколы были одобрены Комитетом по уходу и использованию животных Университета Фудань. Все операции проводились под анестезией пентобарбиталом натрия в дозе 40 мг / кг, и были предприняты все усилия, чтобы минимизировать страдания, такие как улучшение качества анестезиологической практики и изучение способов снижения риска инфекций.

Экспериментальный протокол 1 (фиг. S1A)

Крыс случайным образом разделили на четыре группы: (i) контрольная группа: крысы получали ежедневные внутрибрюшинные (i.п.) введение 1 мл физиологического раствора в течение 7 дней; (ii): группа гентамицина (гент): получала ежедневно внутрибрюшинно. инъекция раствора гентамицина сульфата (Tianjin Pharmaceutical Company, Китай) в дозе 100 мг / кг / МТ в течение 7 дней, что, как хорошо известно, вызывает значительную нефротоксичность у крыс [22], [23]; (iii) Группа N 2 + гентамицин (N 2 + гент): крысы, предварительно обработанные 70% -ным азотом, уравновешенным 30% -ным кислородом, в течение 2 часов, затем 7 дней лечения гентамицином, начатых через 24 часа, и повторно обработанные 70% азота в течение 30 минут на 2, 4 и 6 день во время 7-дневного приема гентамицина; (iv) Группа Хе + гентамицин (Хе + гент): крысы, получавшие 70% ксенон (сбалансированный с 30% кислородом) периодически до и во время введения гентамицина, аналогично группе N 2 + гентамицин.На 2 900–40 4, 4 и 7 день крыс помещали в метаболические клетки индивидуально на 24 часа и собирали мочу для определения клиренса креатинина (Ccr) и N-ацетил-β-D-глюкозаминидазы (NAG). Шесть крыс в каждой группе были умерщвлены под анестезией на 2, 4 и 7 дни после последней инъекции гентамицина, соответственно. Кровь брали из брюшной аорты для определения креатинина и азота мочевины. Почки собирали и взвешивали. Одна почка использовалась для гистологического, иммуногистохимического анализа.Одну почку замораживали в жидком азоте и хранили при -80 ° C для дальнейшего анализа.

Протокол эксперимента 2 (фиг. S1B)

Крыс случайным образом разделили на три группы, по шесть животных в каждой: (i) контроль: крысы, не подвергавшиеся лечению; (ii) Xe: крысы, подвергшиеся воздействию 70% ксенона и 30% кислорода в течение 2 часов; (iii) N 2 : крысы, подвергшиеся воздействию 70% N 2 , уравновешенное 30% кислородом в течение 2 часов. Крыс умерщвляли через 24 часа спустя . Почки были быстро удалены для дальнейшего анализа.

Общий анализ мочи и химический анализ крови

Уровень N-ацетил-β-D-глюкозаминидазы (NAG) в моче определяли с помощью стандартного диагностического набора (Jiancheng Biotech., Nanjing, China) в соответствии с инструкциями производителя. Уровни креатинина мочи (Ucr), креатинина сыворотки (Scr) и азота мочевины крови (BUN) измеряли с помощью автоматического анализатора (Vet test 8008, США). Клиренс креатинина (Ccr) рассчитывали по стандартной формуле. Фактор некроза опухоли альфа (TNF-α) в сыворотке определяли с использованием коммерческих наборов для твердофазного иммуноферментного анализа (ELISA) (R&D Systems, Inc., Миннеаполис, США) в соответствии с инструкциями производителя.

Гистопатологические исследования

Срезы почек фиксировали в 10% формалине, заливали парафином, разрезали на срезы 5 мкм и окрашивали гематоксилином и эозином. Ткани оценивали с помощью световой микроскопии. Гистопатологическая оценка проводилась патологом, не знакомым с протоколом эксперимента, в соответствии с тяжестью повреждения канальцев коркового вещества почек по полуколичественной шкале [24]: без повреждений (0), легкие: <25% (1), умеренные: <50% (2), тяжелые: <75% (3) и очень тяжелые:> 75% (4).Было исследовано более 20 последовательных полей при увеличении в 400 раз.

TUNEL Staining

Опосредованный терминальной дезоксинуклеотидилтрансферазой метод мечения ник-концов dUTP (TUNEL) был использован для оценки апоптоза на основе маркировки разрывов цепей ДНК в соответствии с протоколом производителя (набор для обнаружения смерти клеток in situ, POD, Roche). Количество TUNEL-положительных клеток из 10 областей случайно выбранной почечной коры подсчитывали под объективом 40-кратного светового микроскопа.

Иммуногистохимия

Иммуногистохимическое окрашивание проводили на парафинированных срезах 4 мкм.После депарафинизации и дегидратации срезы инкубировали с 3% H 2 O 2 в течение 10 минут для устранения эндогенной пероксидазной активности и обрабатывали нормальной козьей сывороткой в ​​течение 20 минут. Затем их инкубировали при 4 ° C в течение ночи с первичными антителами против ED-1 (кроличьи моноклональные, 1-100, Novus, США) или TNF-α (кроличьи поликлональные, 1-2000, Abcam, США). Затем срезы инкубировали с вторичным антителом, конъюгированным с пероксидазой хрена (анти-кроличий IgG). После промывки PBS срезы окрашивали 3,3′-диаминобензидином (Sigma), затем контрастировали гематоксилином и оценивали под световой микроскопией.

Определение перекиси липидов

Малоновый диальдегид (MDA), как встречающийся в природе продукт перекисного окисления липидов, определяли с использованием супернатанта гомогената коркового вещества почек в соответствии с протоколом производителя (набор для анализа TBARS, Cayman Chemical Company, США).

Обратная транскрипция в реальном времени – ПЦР

Полную РНК из почечной ткани экстрагировали с помощью Trizol (Invitrogen) с последующим количественным определением и затем подвергали обратной транскрипции (набор реагентов PrimeScript® RT, TaKaRa, Япония).Продукт кДНК использовали для ПЦР в реальном времени (SYBR® Premix Ex Taq ™ TaKaRa, Япония). Последовательности праймеров ПЦР (Сангон, Шанхай, Китай) были следующими: HIF-1α прямой 5′-CACTGC -ACAGGCCACATTCAT-3 ‘, обратный 5′-AAGCAGGTCATAGGCGGTTTC-3′ ; HIF-2α, прямой 5′-GTCACCAGAACTTG TGC-3 ‘, обратный 5′-CAAAGATGCTGTT-3′ ; VEGF прямой 5′-CAGCTATTGCCG TCCAATTGCA -TGGA-3 ‘, обратный 5′-CCAGGGCTTCATCATTGCA-3′ ; PHD1 вперед 5′-GTGGCGAGGCAAGTTCTAGGC-3 ‘, обратный 5′-CCTGCACAGTGGC GGATTAC-3′ ; PHD2 вперед 5′- CCATGGTCGCCTGTTACCC-3 ‘, обратный 5′- CGTACCTTGTGGCGTATGCAG-3′ ; PHD3 вперед 5′- CCTGGTCTGATAGGA GGAGGTTT-3 ‘, обратный 5′- GCCCTTTCTAGAGGCGATAATGT -3′ ; β-актин прямой 5′- GATTACTGCCCTGGCTCCTA -3 ‘, обратный 5′-TCATCGTACTCCTGC TTGCT-3′ .Уровень экспрессии miR-21 был количественно определен с использованием обратной транскрипции в реальном времени ПЦР с химическим анализом Taqman (Applied Biosystems), как описано ранее [25]. 5S рибосомная РНК и мРНК β-актина использовали в качестве эндогенного контроля для миРНК и мРНК соответственно. Относительные экспрессии генов рассчитывали в соответствии с методом ΔΔCt. Относительные уровни мРНК были выражены как 2 -ΔΔCt (Tn) и соотношения к контролю.

Приготовление гомогенатов и вестерн-блот-анализ

Рассеченные корковые слои почек гомогенизировали в ледяном буфере для лизиса (25 ммоль / л Na-HEPES, 1 ммоль / л EDTA и 0.1 ммоль / л ФМСФ). После центрифугирования при 10000 g в течение 5 минут при 4 ° C супернатант собирали. Образцы (50 мкг / дорожка) загружали и разделяли электрофорезом в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE), а затем переносили на мембраны из дифторида поливинилидина. Мембраны блокировали 5% обезжиренным молоком и гибридизировали с первичными антителами против HIF-1α (кроличьи поликлональные 1∶500, Abcam, США), HIF-2α (кроличьи поликлональные 1∶1000, Novus, США), пролил-4. белки, содержащие -гидроксилазный домен (PHD1, PHD2, PHD3, goat polyclonal, 1∶200, Sant Cruz Biotechnology Inc.), VEGF (поликлональный 1–1000, Abcam, США), затем вторичные антитела, конъюгированные с пероксидазой хрена, и визуализация с помощью усиленной хемилюминесцентной системы. Результаты были нормализованы с помощью α-тубулина или GAPDH и выражены в виде отношения к контролю.

Статистический анализ

Статистический анализ проводился с использованием статистического программного обеспечения SPSS Version 16.0. Данные были представлены в виде средних значений ± стандартное отклонение. Различия между средними значениями для нескольких групп оценивали с помощью однофакторного дисперсионного анализа. Значение p <0.05 считалось значительным.

Результаты

Лечение Xe защищало функцию почек от повреждения гентамицином

У животных наблюдалось заметное ухудшение функции почек после 7 дней ежедневных инъекций гентамицина. Это характеризовалось значительным повышением уровня креатинина в сыворотке, уровня азота мочевины в крови и снижением уровня клиренса креатинина, который достиг пика через 48 часов после последней инъекции (Scr, 1,42 ± 0,21 мг / дл; BUN, 29,72 ± 6,85 ммоль / л; Ccr, 1,61 ± 0,38 мл / мин / кг.чб). Животные, которые подвергались периодическому воздействию 70% Xe, уравновешенного 30% кислородом, демонстрировали небольшое, но не значимое снижение Scr, BUN и повышение уровня Ccr через 48 часов после последней инъекции гентамицина (Scr, 1,00 ± 0,11 мг / сут. дл; АМК, 21,59 ± 5,11 ммоль / л; Ccr, 2,28 ± 0,36 мл / мин / кг массы тела). Через 4 дня после последнего введения гентамицина произошло значительное улучшение функциональных параметров почек в группе Хе + гентамицин по сравнению с контрольными группами гентамицина или N 2 + гентамицин (Scr, 0.59 ± 0,07 мг / дл по сравнению с . 1,18 ± 0,27 мг / дл и 0,80 ± 0,11 мг / дл; АМК: 12,47 ± 5,40 ммоль / л по сравнению с 18,80 ± 5,62 ммоль / л и 24,25 ± 13,21 ммоль / л; Ccr, 4,06 ± 0,62 мл / мин / кг веса по сравнению с 2,47 ± 0,38 мл / мин / кг веса и 2,37 ± 0,40 мл / мин / кг веса, p <0,05) (A, B и C). Лечение 70% N 2 не привело к значительному снижению повреждения почек по сравнению с группой, получавшей гентамицин.

Ксенон защищает функцию почек от нефротоксичности, вызванной гентамицином.

A: концентрация креатинина в сыворотке (Scr) во всех группах через 2, 4 и 7 дней после 7-дневной инъекции гентамицина или физиологического раствора.B: концентрация азота мочевины крови (АМК). C: клиренс креатинина (Ccr). D: N-ацетил-β-D-глюкозаминидаза в моче (NAG). Обработка ксеноном значительно ослабляла повышение Scr, BUN, NAG и снижение Ccr через 4 дня после 7-дневной инъекции гентамицина по сравнению с группой гентамицина и группой N 2 + гентамицин. * P <0,01 по сравнению с контрольной группой ; #P <0,05 по сравнению с группой Xe + гентамицин. n = 6 / группа в каждый момент времени.

NAG показал более высокую активность в моче животных, которым вводили гентамицин, через 2 и 4 дня после последней инъекции по сравнению с контролем (P <0.01). Активность ферментов была значительно снижена в группе обработки Xe по сравнению с группой обработки гентамицином и группой обработки N 2 в двух временных точках (P <0,05) (D).

Функциональная защита сопровождалась ослаблением повреждения канальцев, апоптоза и окислительного стресса, но не воспалением. группы, особенно через 48 часов после последней инъекции гентамицина.Структурные нарушения были наиболее заметными в проксимальных сегментах коры и включали массивную дегенерацию эпителиальных клеток канальцев, десквамацию и некроз, обнаженные базальные мембраны, белковые или клеточные цилиндры и инфильтрацию воспалительных клеток. Напротив, у животных, получавших Xe, наблюдались легкие или умеренные изменения эпителия канальцев, такие как очаговая вакуолизация, гранулярность цитоплазмы и спорадический некроз клеток (2).

Влияние ксенона на морфологию почек.

A: репрезентативные изображения коры почечных срезов из всех групп через 2, 4 и 7 дней после 7-дневной инъекции гентамицина или физиологического раствора соответственно.(окрашивание гематоксилин-эозином, 100 ×). B: повреждение почечных канальцев, оцениваемое по шкале гистологии во всех группах. Лечение ксеноном значительно ослабило повреждение почечных канальцев через 2 и 4 дня после 7-дневной инъекции гентамицина по сравнению с группой гентамицина и группой N 2 + гентамицин. * P <0,01 по сравнению с контрольной группой; #P <0,05. по сравнению с группой Xe + гентамицин, n = 6 / группа в каждый момент времени.

Морфологические свидетельства нефротоксичности, вызванной гентамицином, оценивали с использованием гистопатологической шкалы повреждения кортикальных канальцев, которая включала некроз или набухание канальцевых клеток, цилиндрические цилиндры, потерю щеточной каймы и инфильтрацию интерстициальных воспалительных клеток в 10 неперекрывающихся полях (20-кратное увеличение) коры.Гистологическая оценка в группе гентамицина через 48 часов составила 3,50 ± 0,22, которая значительно снизилась до 2,67 ± 0,33 ( P <0,05) в группе лечения Xe. Аналогичное изменение также произошло через 4 дня, что параллельно с улучшением функции почек. Группа лечения N 2 не показала значимых отличий от группы, получавшей гентамицин, по гистологическим показателям ().

Чтобы оценить повреждение почек на клеточном уровне, для анализа апоптоза почечных клеток использовали опосредованное терминальной дезоксинуклеотидилтрансферазой дигоксигенин-дезоксиуридиновое окрашивание с помощью ник-конца мечения (TUNEL).TUNEL-положительные клетки были заметны в проксимальных канальцах почек (), которых было значительно меньше в группе Хе + гентамицин (16,50 ± 0,76), чем в группе гентамицина (20,40 ± 0,91) в почках, взятых через 2 дня после последней инъекции ( P ). <0,05). Подобные различия также наблюдались в 4-дневный момент времени (B). Группа лечения N 2 не показала существенных отличий от группы, получавшей гентамицин, в отношении апоптоза в эти два момента времени.

Обработка ксеноном значительно ослабила апоптоз клеток и снизила содержание малонового диальдегида (МДА) в почках.

A: TUNEL-положительные клетки в срезах почек из всех групп через 2 и 4 дня после 7-дневной инъекции гентамицина. B: среднее значение TUNEL-положительных клеток в срезах почек из всех групп. C: концентрация МДА в почечной ткани через 4 дня после 7-дневной инъекции гентамицина. * P <0,01, ** P <0,05 по сравнению с контрольной группой ; #P <0,05. по сравнению с группой Xe + гентамицин, n = 6 / группа в каждый момент времени.

Малоновый диальдегид (МДА), естественный продукт перекисного окисления липидов, используется в качестве индикатора повреждения, вызванного окислительным стрессом [26].Для определения содержания МДА в тканях почек использовали анализ реактивных веществ с тиобарбитуровой кислотой (TBARS). Мы обнаружили, что концентрация МДА в тканях коры почек была значительно снижена в группе лечения Xe через 4 дня после последнего введения гентамицина по сравнению с группой гентамицина и группой лечения N 2 (1,87 ± 0,02 мкмоль / л против 2,13 ± 0,10 мкмоль / л и 2,06 ± 0,05 мкмоль / л; P <0,05) (C).

Чтобы изучить влияние лечения Xe на воспалительную реакцию в почках, мы исследовали экспрессию белка маркера макрофагов / моноцитов (ED-1) и фактора некроза опухоли-альфа (TNF-α).Иммуногистохимическое окрашивание показало, что экспрессия TNF-α была в основном локализована на поврежденных тубулоинтерстиций, а клетки ED-1 + (макрофаги) были в большом количестве в перитубулярных пространствах (A и B). Количественно экспрессия обоих белков была значительно выше в трех экспериментальных группах по сравнению с контрольной группой (P <0,01), тогда как не было значительных различий в экспрессии между группами, получавшими Xe + гентамицин, гентамицин и N 2 + гентамицин (P > 0.05) (C и D). Концентрация TNF-α в сыворотке была значительно повышена в трех экспериментальных группах по сравнению с контрольной группой (P <0,01), в то время как не было значительных различий между группами, получавшими Xe + гентамицин, гентамицин и N 2 + гентамицин (P> 0,05. ) (E). Эти результаты показали, что лечение Xe не ослабляет воспаление в почке, поврежденной гентамицином.

Иммуногистохимическое окрашивание ED-1 и TNF-α в почечных срезах.

Репрезентативные микрофотографии, 100 ×, A – B: коричневый цвет указывает на положительное окрашивание.A: экспрессия ED-1 в почках через 2 и 4 дня после 7-дневной инъекции гентамицина. B: экспрессия TNF-α в почках. C: среднее значение ED-1 положительных клеток в почечных срезах из всех групп. D: количество областей с положительным окрашиванием TNF-α в почечных срезах во всех группах. E: Уровень TNF-α в сыворотке. Не было значительных различий в экспрессии ED-1 и TNF-α в почках между группой гентамицина, группой N 2 + гентамицин и группой Xe + гентамицин. Уровень сывороточного TNF-α существенно не отличался между экспериментальными группами.* P <0,01 по сравнению с контрольной группой , n = 6 / группа в каждый момент времени.

Предварительная обработка Xe индуцировала экспрессию HIF-2α и его нижестоящего эффектора, но не влияла на HIF-1α

Для изучения механизмов, лежащих в основе индуцированной Xe ренопротекции, мы использовали дополнительный эксперимент, в котором животных лечили 70% Xe или 70% N 2 уравновешивается 30% кислородом в течение 2 часов. Затем мы выделили почки крысы через 24 часа и измерили экспрессию HIF-1α и HIF-2α, а также выбранный нижестоящий эффекторный VEGF.Количественный анализ экспрессии мРНК с помощью ОТ-ПЦР показал, что HIF-2α и VEGF были значительно выше в группе предварительной обработки Xe, чем в группе предварительной обработки N 2 и контрольной (P <0,05), в то время как экспрессия мРНК HIF-1α не пострадала. ().

Предварительная обработка Xe активировала HIF-2α и VEGF, но не HIF-1α.

A: относительные уровни мРНК HIF-1α, HIF-2α и VEGF по данным ПЦР-анализа с обратной транскриптазой в реальном времени из группы N 2 и группы Xe через 24 часа после предварительной обработки N 2 или только Xe.Xe увеличивал уровень мРНК HIF-2α и VEGF, но не HIF-1α. B – F: репрезентативные изображения вестерн-блоттинга HIF-1α, HIF-2α и VEGF из группы N 2 и группы Xe через 24 часа после N 2 или предварительной обработки только Xe и из группы гентамицина, N 2 + группа гентамицина, группа Xe + гентамицин и контрольная группа через 48 часов или 4 дня после 7-дневного введения гентамицина. Относительные интенсивности блотов HIF-1α, HIF-2α и VEGF, нормализованные к контролю. B: Xe или N 2 предварительная обработка или введение гентамицина не влияли на HIF-1α.Через 24 часа после предварительной обработки N 2 или Xe или через 48 часов после 7-дневного введения гентамицина. Уровень HIF-1α практически не обнаруживается во всех группах. C-D: предварительная обработка Xe или обработка гентамицином значительно повышала регуляцию HIF-2α и VEGF через 24 часа после предварительной обработки Xe или через 48 часов после 7-дневного введения гентамицина. E-F: группа Xe + гентамицин значительно активировала HIF-2α и VEGF через 4 дня после 7-дневного введения гентамицина. * P <0,05, ** P <0,01 по сравнению с контрольной группой , #P <0.05 по сравнению с группой Хе + гентамицин, n = 5–6.

Как показано выше, параллельно с изменением уровней мРНК предварительная обработка Xe увеличивала экспрессию белков HIF-2α и VEGF в почках, но не HIF-1α. Мы обнаружили, что введение гентамицина также увеличивало экспрессию белков HIF-2α и VEGF, и не было значительных различий в экспрессии через 48 часов после 7-дневного введения гентамицина между группами, получавшими гентамицин, Xe + гентамицин и N 2 + гентамицин. Однако через 4 дня после последнего введения гентамицина HIF-2α и VEGF были значительно выше в группе Xe + гентамицин, чем в группе гентамицина и N 2 + гентамицин (P <0.05). Во всех экспериментальных группах HIF-1α не был затронут и присутствует только на едва обнаруживаемом уровне.

Влияние предварительной обработки Xe на экспрессию PHD в почках

Сообщалось, что пролилгидроксилазы HIF, PHD1, PHD2 и PHD3 вносят вклад в регуляцию как HIF-1α, так и HIF-2α [27], [28], однако эффекты PHD на различные изоформы HIF-α не были эквивалентными. 26 Мы обнаружили, что через 24 часа после воздействия 70% мРНК Xe экспрессия PHD1 значительно снизилась в коре почек, в то время как PHD2 значительно увеличилась, а PHD3 не пострадала.Уровни мРНК PHD существенно не различались в группе, получавшей N 2 , по сравнению с контролем (A). Кроме того, экспрессия белков PHD1, PHD2 и PHD3 в коре головного мозга параллельна паттернам экспрессии мРНК (B). На основании постоянных изменений в экспрессии мРНК и белков PHD в почечной коре мы можем предположить, что лечение Xe может регулировать PHD на уровне транскрипции.

Предварительная обработка Xe активировала PHD2, подавляла PHD1, но не влияла на экспрессию PHD3.

A: относительные уровни мРНК PHD1, PHD2 и PHD3 по результатам анализа обратной транскриптазы (RT) -PCR в реальном времени в почках через 24 часа после предварительной обработки 70% N 2 или 70% Xe. B: репрезентативные изображения вестерн-блоттинга PHD1, PHD2 и PHD3 в почках через 24 часа после предварительной обработки N 2 или Xe. Относительные интенсивности блотов PHD1, PHD2 и PHD3, нормализованные к контролю. * P <0,05 по сравнению с . контрольная группа.

Xe Pretreatment Upregulated miR-21

Роль miRNAs в гентамицине-индуцированном остром повреждении почек неизвестна.Было показано, что miR-21 является сильным антиапоптотическим фактором [29], [30]. Учитывая, что обработка Xe ослабляла апоптоз канальцевых клеток (см. Выше), мы измерили экспрессию miR-21 в наших образцах коры почек с помощью ПЦР Taqman в реальном времени. Интересно, что мы обнаружили, что предварительная обработка Xe значительно усиливала экспрессию miR-21 в почках взрослых крыс через 24 часа после воздействия 70% Xe (P <0,05) (A). Мы также обнаружили, что обработка гентамицином активировала экспрессию miR-21 через 4 дня после 7-дневного введения гентамицина, и группа Xe + гентамицин показала более высокую экспрессию miR-21, чем группа гентамицина или N 2 + гентамицин (B).

Экспрессия miR-21 в почках крысы.

A: Предварительная обработка Xe значительно активировала miR-21 в почках крыс через 24 часа после предварительной обработки Xe. B: лечение гентамицином значительно увеличивало miR-21 через 4 дня после 7-дневного введения гентамицина, которая дополнительно увеличивалась под действием Xe. * P <0,05 по сравнению с . контрольная группа, ** P <0,01 против . контрольная группа, #P <0,05 по сравнению с группой Xe + гентамицин, n = 5–6.

Обсуждение

Это исследование впервые показывает, что периодическое воздействие Xe может защитить от нефротоксичности, вызванной гентамицином.На сегодняшний день большинство исследований ксенона сосредоточено на эффекте предварительного кондиционирования и органопротекции против ишемического реперфузионного повреждения. В почках Ma et al. [21] продемонстрировали, что прекондиционирование Xe защищает от ишемического реперфузионного повреждения почек у мышей за счет повышенной экспрессии HIF-1α. Ризви и др. [31] обнаружили, что 75% Xe оказывает защитное действие на лишенные кислорода и глюкозы клетки канальцевых почек человека за счет увеличения экспрессии p-Akt, HIF-1α и Bcl-2. Настоящее исследование было первым исследованием влияния Хе на нефротоксичность лекарств и показало, что периодическое воздействие Хе как до, так и во время введения гентамицина обеспечивает значительную морфологическую и функциональную защиту от нефротоксичности, вызванной гентамицином.Это исследование исследует новую идею и станет платформой для дальнейших фундаментальных научных исследований и клинических исследований этого инертного газа в роли защиты почек.

Гентамициновое повреждение почек характеризуется некрозом эпителиальных клеток почечных канальцев, апоптозом, воспалительной реакцией, окислительным стрессом и сокращением сосудов. Дисфункция митохондрий – один из первых показателей нефротоксичности, вызванной гентамицином, которая вызывает чрезмерное количество АФК, что приводит к морфологическим и функциональным изменениям.Недавнее исследование продемонстрировало, что применение нацеленного на митохондрии антиоксиданта SkQR1 обеспечивает ренопротекторные эффекты против нефротоксичности, вызванной гентамицином, и реперфузионного повреждения почек у крыс за счет нормализации уровня АФК и продуктов перекисного окисления липидов в митохондриях почек [32], [33]. Силачев и др. [34] продемонстрировали, что ишемическое прекондиционирование почек, и антиоксидант SkQR1 могут вызывать высвобождение ЭПО из почек и уменьшать повреждение головного мозга за счет перекрестного обмена данными между почками и мозгом.Настоящее исследование показало, что Xe ослабляет некроз канальцев, апоптоз и окислительный стресс, но не влияет на воспаление. Более того, мы обнаружили, что обработка как 70% ксеноном, так и гентамицином активировала HIF-2α и его последующий эффекторный VEGF. Хе в сочетании с гентамицином значительно повышал регуляцию HIF-2α и VEGF через 4 дня после 7-дневного введения гентамицина. Механизм, лежащий в основе позитивной регуляции HIF-2α, может быть множественным. АФК могут быть дополнительным фактором, который индуцирует экспрессию HIF и активирует защитные пути.Похоже, что ренопротекторный эффект Xe против повреждения гентамицином может включать повышающую регуляцию HIF-2α и его последующих эффекторов, таких как VEGF и EPO.

Экспрессия HIF1-α и HIF2-α может быть индуцирована в почках по-разному в зависимости от типа стимула, типа почечных клеток и зоны почек [35], [36]. HIF-2α усиливает экспрессию многих генов, участвующих в эритропоэзе, гликолизе и ангиогенезе, таких как VEGF [37] и EPO [38] – [40], которые важны для поддержания нормальной функции почек.Кодзима и др. [41] продемонстрировали, что HIF-2α обеспечивает защиту от ишемического повреждения почек за счет снижения окислительного стресса, и что повышенная регуляция HIF-2α в эндотелии улучшает повреждение почек, вызванное ишемией-реперфузией. HIF состоят из отдельных α-субъединиц (HIF-1a, HIF-2a или HIF-3a) и общей β-субъединицы [42] и регулируются белками, содержащими домен пролил-4-гидроксилазы (PHD1, PHD2, PHD3 ) путем гидроксилирования остатков пролина на субъединицах HIF-a. Все изоформы PHD были обнаружены в почках, и все они регулируют экспрессию HIF [42], [43].Предыдущие исследования показали, что действие PHD на разные изоформы HIF-α не было эквивалентным, при этом PHD2 имел большее влияние на HIF-1α, чем HIF-2α. Напротив, было обнаружено, что PHD3 имеет большее влияние на HIF-2α, чем HIF-1α [42]. Wang et al. [44] продемонстрировали, что ингибирование PHD перед ишемической реперфузией почек защищает почки за счет стабилизации HIF-1α и -2α и активации генов-мишеней HIF. Недавно мы сообщили, что HIF-1α и HIF-2α могут избирательно активироваться ингибитором PHD L-мимозином в различных физиологических условиях [45].В настоящем исследовании мы обнаружили, что предварительная обработка Xe подавляла PHD1 и усиливала PHD2, но не влияла на экспрессию PHD3 в почечной коре. Мы предполагаем, что и PHD1, и PHD2 могут участвовать в регуляции HIF-2α. Подавление PHD1 первоначально может активировать HIF-2α. Высокий уровень HIF-2α может затем увеличить активность PHD2, ограничивая повышающую регуляцию HIF-2α. Точное взаимодействие между изоформами PHD и HIF при воздействии Xe и нефротоксичность гентамицина еще предстоит выяснить.

miRNA – это недавно открытый класс регуляторных молекул РНК, которые регулируют экспрессию генов в первую очередь на посттранскрипционном уровне [46]. miRNAs, как известно, играют важную и повсеместную роль во многих жизненно важных биологических процессах, включая развитие, дифференцировку клеток, пролиферацию и апоптоз. Было показано, что некоторые miRNAs, такие как семейство miR-29, miR-382 и miR-21, имеют отношение к повреждению и восстановлению почек [25], [47] – [49]. Было показано, что miR-21 способствует пролиферации, ингибирует апоптоз и действует как сильный антиапоптотический фактор [29], [30], [47].Наша предыдущая работа показала, что повышающая регуляция miR-21 вносит вклад в защиту от почечного ишемического-реперфузионного повреждения, включая апоптоз почечных клеток, вызываемый ишемическим прекондиционированием [49]. В этом исследовании мы обнаружили, что Xe активирует miR-21, сильный антиапоптотический фактор, в почках и ослабляет апоптоз канальцевых клеток, miR-21 может вносить вклад в обусловленное Xe улучшение почечного повреждения, вызванного гентамицином.

Есть некоторые возможные ограничения этого газа, такие как высокая стоимость и дефицит, которые ограничивают его использование небольшим количеством экспериментальных и клинических испытаний, а полный неблагоприятный профиль ксенона был неизвестен из-за ограниченного количества исследований.Однако безопасность и эффективность ксеноновой анестезии оценивалась в крупных клинических испытаниях [50], и с развитием системы доставки ксенона с замкнутым контуром и прогрессом в технологии газовой экстракции дозирование ксенона и стоимость существенно снизятся [51]. Принимая во внимание стоимость и возможную токсичность, Xe следует использовать с осторожностью.

Таким образом, настоящее исследование выявило новый эффект Хе в защите от нефротоксичности гентамицина. Дальнейшие экспериментальные исследования и клинические испытания Xe будут полезны для получения более глубокого понимания ренопротекции Xe и ее клинического применения.

Дополнительная информация

Рисунок S1

Протоколы экспериментов 1 (A) и 2 (B). НС, физиологический раствор; Хе, ксенон; N 2 , азот; гент, гентамицин; N 2 + г, азот + гентамицин; Хе + г, ксенон + гентамицин; РФ, функция почек; TUNEL, мечение ник-концов dUTP, опосредованное терминальной дезоксинуклеотидилтрансферазой; ИГХ, иммуногистохимия; q-ПЦР, количественная полимеразная цепная реакция; WB, вестерн-блоттинг.

(TIF)

Заявление о финансировании

Эта работа была поддержана грантами 30871176 и 30971374 (для XD) от Национального фонда естественных наук Китая, 12DJ1400200 (для XD) от Комитета по основным проектам фундаментальных исследований технологий в Шанхае Китая; и гранты HL082798, HL111580 и HL029587 (для ML) от Национальных институтов здравоохранения.Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Список литературы

1. Бинсвангер У (1997) Острая почечная недостаточность: меняются причины? Почечный кровяный пресс Res 20: 163. [PubMed] [Google Scholar] 2. Lopez-Novoa JM, Quiros Y, Vicente L, Morales AI, Lopez-Hernandez FJ (2011) Новое понимание механизма нефротоксичности аминогликозидов: интегративная точка зрения. Почка Int 79: 33–45. [PubMed] [Google Scholar] 3. Quiros Y, Vicente-Vicente L, Morales AI, López-Novoa JM, López-Hernández FJ (2011) Комплексный обзор механизмов, лежащих в основе цитотоксичности гентамицина почечных канальцев.Toxicol Sci 119: 245–256. [PubMed] [Google Scholar] 4. Мартинес-Сальгадо C, Лопес-Эрнандес FJ, Лопес-Новоа JM (2007) Клубочковая нефротоксичность аминогликозидов. Токсикол Аппл Фармакол 223: 86–98. [PubMed] [Google Scholar] 5. Эль Моудден М., Лоран Дж., Мингеот-Леклерк М.П., ​​Конус Х.С., Кампс Дж. И др. (2000) Апоптоз проксимальных канальцев почек у крыс, получавших низкие дозы аминогликозидов. Противомикробные агенты Chemother 44: 665–675. [Бесплатная статья PMC] [PubMed] [Google Scholar] 6. Edwards JR, Diamantakos EA, Peuler JD, Lamar PC, Prozialeck WC (2007) Новый метод оценки некроза эпителиальных клеток проксимальных канальцев в интактной почке крысы с использованием гомодимера этидия.BMC Physiol 7: 1–14. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Bledsoe G, Crickman S, Mao J, Xia C, Murakami H, et al. (2006) Калликреин / кинин защищает от нефротоксичности, вызванной гентамицином, путем ингибирования воспаления и апоптоза. Трансплантация нефрола Dial 21: 624–633. [PubMed] [Google Scholar] 8. Калаярасан С., Прабху П.Н., Шрирам Н., Маникандан Р., Арумугам М. и др. (2009) Диаллилсульфид усиливает действие антиоксидантов и подавляет воспаление за счет активации Nrf2 против нефротоксичности, вызванной гентамицином, у крыс Wistar.Eur J Pharmacol 606: 162–171. [PubMed] [Google Scholar] 9. Cuzzocrea S, Mazzon E, Dugo L, Serraino I, Di Paola R и др. (2002) Роль супероксида в опосредованной гентамицином нефропатии у крыс. Eur J Pharmacol 450: 67–76. [PubMed] [Google Scholar] 10. Chen LF, Kaye D (2009) Текущее использование старых антибактериальных агентов: полимиксинов, рифамицинов и аминогликозидов. Инфекция Dis Clin North Am 23: 1053–1075. [PubMed] [Google Scholar] 11. Али Б.Х., Аль Зааби М., Бланден Г., Неммар А. (2011) Экспериментальная нефротоксичность гентамицина и агенты, которые ее изменяют: мини-обзор последних исследований.Базовый клин фармакол 109: 225–232. [PubMed] [Google Scholar] 12. Гото Т., Сува К., Уэзоно С., Ичиносе Ф., Учияма М. и др. (1998) Коэффициент распределения ксенона в крови и газах может быть ниже общепринятого. Br J Anaesth 80: 255–256. [PubMed] [Google Scholar] 13. Лахманн Б., Армбрустер С., Шайрер В., Ландстра М., Трубборст А. и др. (1990) Безопасность и эффективность ксенона при рутинном использовании в качестве ингаляционного анестетика. Ланцет 335: 1413–1415. [PubMed] [Google Scholar] 14. Rossaint R, Reyle-Hahn M, Schulte Am Esch J, Scholz J, Scherpereel P и др.(2003) Многоцентровое рандомизированное сравнение эффективности и безопасности ксенона и изофлурана у пациентов, перенесших плановые операции. Анестезиология 98: 6–13. [PubMed] [Google Scholar] 15. Нойкирхен М., Хипп Дж., Шефер М.С., Бранденбургер Т., Бауэр I и др. (2012) Стабильность сердечно-сосудистой системы и неизменная симпатическая активность мышц во время анестезии ксеноном: роль ингибирования захвата норадреналина. Br J Anaesth 109: 887–896. [PubMed] [Google Scholar] 16. Ма Д., Хоссейн М., Петет Г.К., Луо И., Лим Т. и др.(2006) Предварительное кондиционирование ксеноном снижает повреждение головного мозга крыс в результате асфиксии новорожденных. J Cereb Blood Flow Metab 26: 199–208. [PubMed] [Google Scholar] 17. Ян Т., Чжуанг Л., Рей Фидальго А.М., Петридес Э., Террандо Н. и др. (2012) Ксенон и севофлуран обеспечивают обезболивание во время родов и защиту мозга плода в перинатальной модели гипоксии-ишемии у крыс. PLoS One 7: e37020. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Вебер NC, Тома О., Вольтер Дж. И., Виртл Н. М., Шлак В. и др. (2005) Механизмы прекондиционирования, индуцированного ксеноном и изофлураном: потенциальная связь с цитоскелетом через путь MAPKAPK -2 / HSP27.Br J Pharmacol 146: 445–455. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Weber NC, Frässdorf J, Ratajczak C, Grueber Y, Schlack W. и др. (2008) Ксенон индуцирует позднюю прекондиционирование сердца in vivo: роль циклооксигеназы 2? Анест Анальг 107: 1807–1813. [PubMed] [Google Scholar] 20. Прекель Б., Шлак В. (2004) Редакционная статья III: Ксенон – сердечно-сосудистая инертность? Br J Anaesth 92: 786–789. [PubMed] [Google Scholar] 21. Ма Д., Лим Т., Сюй Дж., Тан Х, Ван И и др. (2009) Прекондиционирование ксеноном защищает от ишемического реперфузионного повреждения почек посредством активации HIF-1α.J Am Soc Nephrol 20: 713–720. [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Яман И., Баликчи Э. (2010) Защитные эффекты nigella sativa против нефротоксичности, вызванной гентамицином, у крыс. Опыт Toxicol Pathol 62: 183–190. [PubMed] [Google Scholar] 23. Karahan I, Ateşşahin A, Yilmaz S, Ceribaşi AO, Sakin F (2005) Защитный эффект ликопина на вызванный гентамицином окислительный стресс и нефротоксичность у крыс. Токсикология 215: 198–204. [PubMed] [Google Scholar] 24. Jiang S, Chen Y, Zou J, Xu X, Zhang X и др.(2009) Разнообразные эффекты предварительного лечения ишемии на долгосрочное повреждение почек, вызванное ишемией-реперфузией. Am J Nephrol 30: 440–449. [PubMed] [Google Scholar] 25. Лю Ю., Тейлор Н. Е., Лу Л., Сша К., Коули А. В. мл. И др. (2010) Медуллярные микроРНК почек у чувствительных к соли Даля крыс: miR-29b регулирует несколько коллагенов и родственных генов. Гипертония 55: 974–982. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Яги К. (1998) Простой анализ уровня общих перекисей липидов в сыворотке плазмы. Методы Мол Биол 108: 101–106.[PubMed] [Google Scholar] 27. Аппельхофф Р.Дж., Тиан Ю.М., Раваль Р.Р., Терли Х., Харрис А.Л. и др. (2004) Дифференциальная функция пролилгидроксилаз PHD1, PHD2 и PHD3 в регуляции фактора, индуцируемого гипоксией. J Biol Chem 279: 38458–38465. [PubMed] [Google Scholar] 28. Lieb ME, Menzies K, Moschella MC, Ni R, Taubman MB (2002) Гены EGLN млекопитающих имеют разные паттерны экспрессии и регуляции мРНК. Биохимическая клетка Биол 80: 421–426. [PubMed] [Google Scholar] 29. Чан Дж. А., Кричевский А. М., Косик К. С. (2005) МикроРНК-21 является антиапоптотическим фактором в клетках глиобластомы человека.Рак Res 65: 6029–6033. [PubMed] [Google Scholar] 30. Cheng Y, Zhu P, Yang J, Liu X, Dong S и др. (2010) Регулируемая ишемическим прекондиционированием miR-21 защищает сердце от ишемии / реперфузионного повреждения посредством антиапоптоза через свою мишень PDCD4. Cardiovasc Res 87: 431–439. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31. Ризви М., Джавад Н., Ли Й., Вискайчипи М.П., ​​Мейз М. и др. (2010) Влияние благородных газов на повреждение клеток трубчатых почек человека, вызванное недостатком кислорода и глюкозы. Эксп Биол Мед 235: 886–891.[PubMed] [Google Scholar] 32. Янкаускас С.С., Плотников Е.Ю., Моросанова М.А., Певзнер И.Б., Зорова Л.Д. и др. (2012) Нацеленный на митохондрии антиоксидант SkQR1 улучшает вызванную гентамицином почечную недостаточность и потерю слуха. Биохимия (Москва). 77: 666–670. [PubMed] [Google Scholar] 33. Плотников Е.Ю., Чупыркина А.А., Янкаускас С.С., Певзнер И.Б., Силачев Д.Н. и др. (2011) Механизмы нефропротекторного действия митохондриально-направленных антиоксидантов при рабдомиолизе и ишемии / реперфузии. Биохим Биофиз Акта 1812: 77–86.[PubMed] [Google Scholar] 34. Силачев Д.Н., Исаев Н.К., Певзнер И.Б., Зорова Л.Д., Стельмашук Е.В. (2012) Антиоксиданты, нацеленные на митохондрии, и удаленное прекондиционирование почек улучшают повреждение мозга за счет перекрестного разговора почек с мозгом. PLoS One 7: e51553. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35. Розенбергер С., Мандриота С., Юргенсен Дж. С., Визенер М. С., Хёрструп Дж. Х. и др. (2002) Экспрессия индуцируемых гипоксией факторов-1α и -2α в гипоксических и ишемических почках крыс. J Am Soc Nephrol 13: 1721–1732.[PubMed] [Google Scholar] 36. Ван З., Танг Л., Чжу К., И Ф., Чжан Ф. и др. (2011) Индуцируемый гипоксией фактор-1a способствует профибротическому действию ангиотензина II в интерстициальных клетках мозгового вещества почек. Почка Int 79: 300–310. [Бесплатная статья PMC] [PubMed] [Google Scholar] 37. Steenhard BM, Freeburg PB, Isom K, Stroganova L, Borza DB, et al. (2007) Развитие почек и экспрессия генов у мышей с нокаутом HIF2alpha. Дев Дин 236: 1115–1125. [PubMed] [Google Scholar] 38. Scortegagna M, Morris MA, Oktay Y, Bennett M, Garcia JA (2003) Член семейства HIF EPAS1 / HIF-2alpha необходим для нормального кроветворения у мышей.Кровь 102: 1634–1640. [PubMed] [Google Scholar] 39. Перси М.Дж., Ферлоу П.В., Лукас Г.С., Ли Х, Лаппин Т.Р. и др. (2008) Мутация усиления функции в гене HIF2A при семейном эритроцитозе. N Engl J Med 358: 162–168. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Палиж А., Розенбергер С., Бондке А., Сциельски Л., Шина А. и др. (2010) Интерстициальные фибробласты, экспрессирующие индуцируемый гипоксией фактор-2a, являются единственными почечными клетками, которые экспрессируют эритропоэтин при стабилизации индуцируемого гипоксией фактора.Почка Int 77: 312–318. [PubMed] [Google Scholar] 41. Кодзима И., Танака Т., Инаги Р., Като Х., Ямасита Т. и др. (2007) Защитная роль индуцируемого гипоксией фактора-2альфа против ишемического повреждения и окислительного стресса в почках. J Am Soc Nephrol 18: 1218–1226. [PubMed] [Google Scholar] 42. Аппельхофф Р.Дж., Тиан Ю.М., Раваль Р.Р., Терли Х., Харрис А.Л. и др. (2004) Дифференциальная функция пролилгидроксилаз PHD1, PHD2 и PHD3 в регуляции фактора, индуцируемого гипоксией. J Biol Chem 279: 38458–38465.[PubMed] [Google Scholar] 43. Ли Н, Йи Ф, Сунди С.М., Чен Л., Хилликер М.Л. и др. (2007) Экспрессия и действие пролил-4-гидроксилазы HIF в почках крыс. Am J Physiol Renal Physiol 292: F207 – F216. [PubMed] [Google Scholar] 44. Ван З., Шлей Г., Тюркоглу Г., Бурцлафф Н., Аманн К.Ю. и др. (2012) Защитный эффект ингибирования пролилгидроксилазы против ишемии почек требует применения до ишемии, но превосходит лечение ЭПО. Трансплантация нефрола Dial 27: 929–936. [PubMed] [Google Scholar] 45.Ю Х, Фанг Й, Лю Х, Чжу Дж, Цзоу Дж и др. (2012) Баланс полезных и вредных эффектов активации фактора, индуцируемого гипоксией, ингибитором пролилгидроксилазы в остаточной почке крысы зависит от времени введения. Трансплантация нефрола Dial 0: 1–9. [PubMed] [Google Scholar] 46. Лян М., Лю Ю., Младинов Д., Коули А. В. мл., Триведи Н. и др. (2009) MicroRNA: новый рубеж в исследованиях почек и артериального давления. МикроРНК: новый рубеж в исследованиях почек и артериального давления. Am J Physiol Renal Physiol 297: F553 – F558.[Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Годвин Дж. Г., Ге X, Стефан К., Юриш А., Туллиус С. Г. и др. (2010) Идентификация сигнатуры микроРНК реперфузионного повреждения ишемии почек. Proc Natl Acad Sci U S A. 107 14339–14344. [Бесплатная статья PMC] [PubMed] [Google Scholar] 48. Кригель А.Дж., Лю Ю., Коэн Б., Сша К., Лю Ю. и др. (2012) MiR-382, нацеленный на калликреин 5, способствует развитию почечного внутреннего мозгового интерстициального фиброза. Physiol Genomics 44: 259–267. [Бесплатная статья PMC] [PubMed] [Google Scholar] 49.Сюй Х, Кригель А.Дж., Лю Й., Уса К., Младинов Д. и др. (2012) Отсроченное ишемическое прекондиционирование способствует защите почек за счет активации miR-21. Почка Int 82: 1167–1175. [Бесплатная статья PMC] [PubMed] [Google Scholar] 50. Wappler F, Rossaint R, Baumert J, Scholz J, Tonner PH и др. (2007) Многоцентровая исследовательская группа по ксенону: многоцентровое рандомизированное сравнение ксенона и изофлурана на функцию левого желудочка у пациентов, перенесших плановую операцию. Анестезиология 106: 463–471. [PubMed] [Google Scholar] 51.Фолкнер С.Д., Дауни Н.А., Мерсер С.Дж., Керр С.А., Сандерс Р.Д. и др. (2012) Ксеноновый рециркуляционный вентилятор для новорожденных поросят: разработка клинических применений ксенона для новорожденных. Eur J Anaesthesiol 29: 577–585. [PubMed] [Google Scholar]

Ксенон как препарат, повышающий эффективность: допинг или просто горячий воздух?

В прошлом месяце журнал The Economist опубликовал статью, в которой говорится, что российские спортсмены использовали ксенон в качестве вещества, улучшающего спортивные результаты, в течение десяти или более лет. Хотя эта практика специально не запрещена Всемирным антидопинговым агентством (ВАДА), она вызывает вопросы о том, что представляет собой допинг и какие практики следует и нельзя разрешать.Редактор CyclingTips Мэтт де Ниф и антидопинговый эксперт доктор Бен Кох проводят расследование.

На вопрос, что представляет собой допинг, а что нет, нелегко ответить, и ВАДА было далеко не последовательным в этом вопросе. Например, было показано, что употребление кофеина улучшает спортивные результаты и ранее было запрещено ВАДА, но теперь больше не считается запрещенным веществом.

Также известно, что спортсмены злоупотребляют парацетамолом и различными противовоспалительными обезболивающими, чтобы помочь им улучшить свои результаты, но они тоже не запрещены.

Аналогичным образом, вопрос о том, следует ли запретить спортсменам использовать ксенон – естественный элемент в воздухе, которым мы дышим, – очень непрост. Но прежде чем мы рассмотрим этические последствия использования ксенона для повышения производительности, мы должны сначала задать вопрос: что такое ксенон и как он улучшает производительность?

Что такое ксенон?

Ксенон – это так называемый «благородный газ», элемент, находящийся в правом углу таблицы Менделеева, который предпочитает не вступать в реакцию с другими элементами.Впервые он был обнаружен в 1898 году, и теперь мы знаем, что он составляет 0,0000087% атмосферы Земли.

Чистый ксенон можно извлечь из воздуха с помощью процесса, известного как «фракционная перегонка», при котором компоненты в воздухе (например, кислород, азот, диоксид углерода и т. Д.) Отделяются и концентрируются. Газ доступен через фармацевтические каналы, а также через, казалось бы, менее уважаемые онлайн-каналы.

В дополнение к его использованию в освещении (см. Изображение), газ ксенон используется в качестве анестетика с 1950-х годов и считается почти идеальным веществом для работы, поскольку у него нет известных побочных эффектов или проблем с токсичностью.

Это контрастирует с более широко используемыми анестезирующими газами, такими как галотан и изофлуран, которые могут вызывать повреждение печени, нарушения сердечного ритма и ряд других осложнений. Если бы не его непомерно высокая стоимость, ксенон, вероятно, использовался бы как анестетик более широко.

Газообразный ксенон также используется для визуализации легких и в ряде других медицинских приложений, включая защиту наших внутренних органов от гипоксических повреждений, то есть от воздействия ограниченного количества кислорода в кровотоке.Есть также предположения, что ксенон может оказать некоторую помощь в замедлении или борьбе с развитием болезни Паркинсона.

Но как ксенон помогает улучшить спортивные результаты? И есть ли связь между ксеноном и выработкой организмом эритропоэтина (ЭПО)?

Ксенон и повышение спортивных характеристик

Исследования показывают, что вдыхание ксенона увеличивает выработку организмом белка, известного как HIF1 Alpha (HIF1A). Если вы хотите узнать больше о HIF1A и о том, как он работает, вы можете прочитать эти статьи, которые мы опубликовали в прошлом году, но упрощенная версия заключается в том, что HIF1A, похоже, действует, стимулируя выработку других соединений в организме, включая ЭПО.

Напоминаем, что ЭПО – это гормон, регулирующий выработку в организме красных кровяных телец. Стимулируйте выработку ЭПО, и вы получите больше красных кровяных телец; получите больше красных кровяных телец, и вы увеличите способность крови переносить кислород по телу. Повышенная способность переносить кислород теоретически может привести к повышению спортивных результатов, особенно когда мы говорим о видах спорта с высокой выносливостью, таких как соревнования на велосипеде. (Щелкните здесь, чтобы узнать больше о том, как работает EPO).

Хотя ксенон и его использование в качестве анестетика было проведено много исследований, мало что было сделано в отношении его способности улучшать спортивные результаты. Но в России есть те, кто клянутся ксеноном и его преимуществами для спортсменов на выносливость.

Использование ксенона в России

20 марта 2006 г. президент Олимпийского комитета России направил директору ЗАО «Центр Атом-Мед» письмо, в котором поблагодарил исследователя и его команду за помощь в «подготовке» сборной России к зимним Олимпийским играм в Турине 2006 г. см. изображение ниже).Из 22 российских спортсменов, завоевавших медали на этих Играх, 15 использовали смесь газов на основе ксенона в рамках своей подготовки – программа подготовки, которая была официально одобрена правительством России.

В презентации, подготовленной в 2010 г. ЗАО «Центр Атом-Мед», говорится, что «методика восстановления на основе ксенона поможет российским спортсменам на Олимпийских играх в Лондоне (2012 г.) и Сочи (2014 г.)». Действительно, в последние недели было много предположений о том, что российские зимние олимпийцы использовали ксенон при подготовке к Играм в Сочи.

Хотя российские официальные лица не подтвердили, правдивы ли такие подозрения, они заявили, что «ничего плохого не было бы», если бы спортсмены использовали ксенон. Аналогичным образом, ЗАО «Центр Атом-Мед» – исследовательский центр с более чем десятилетним опытом использования таких газов, как ксенон, для повышения производительности в спорте высших достижений, – почти не пытается скрыть тот факт, что они использовали ксенон для улучшения показателей спортсменов. производительность в течение многих лет. По сути, работа компании в этом направлении отмечается.

Но улучшает ли ксенон спортивные результаты?

Вышеупомянутая презентация ЗАО «Центр Атом-Мед» в 2010 году цитирует исследование, в котором проверялись спортивные результаты ряда профессиональных спортсменов до и после применения ксенона, включая использование плацебо в случае некоторых спортсменов. Как сообщается, исследование показало, что MedXenon, марка газовой смеси ксенона, принадлежащая ЗАО «Центр Атом-Мед», действует всего за пять минут после нанесения и имеет продолжительный эффект до 80 часов.

Хотя сложно оценить, насколько тщательным является исследовательское тестирование в данном случае – особенно с учетом того, что тестируемый продукт принадлежит агентству, занимающемуся его производством и продажей, – правительство России признает работу, проводимую в ЗАО «Центр Атом-Мед», и поддержал использование ксенона российскими спортсменами. Действительно, документ, созданный в 2010 году Российским государственным научно-исследовательским институтом Министерства обороны США, включает следующий абзац (в переводе с русского оригинала) о том, как лучше всего вводить ксенон спортсменам:

Ингаляцию можно вводить как однократную дозу, так и многократно (ступенчато), в зависимости от продолжительности физических нагрузок.Многоступенчатая ингаляция оказывается более эффективной. Эффект от ингаляции проявляется через 48-72 часа после процедуры и уменьшается после этого.

Рекомендуется выполнять процедуру ингаляции два-три раза в течение семи-десяти дней. Для повышения эффективности процедуры рекомендуется проводить ее не менее чем за 24 часа до начала соревнований, за два-три часа до сна.

Слайд из ЗАО «Центр Атом-Мед», показывающий, как нужно вводить ксенон спортсменам.

В документе говорится, что для введения смеси от двух до трех литров, содержащей газообразный ксенон в концентрации от 30 до 60%, требуется от 45 секунд до трех минут. Концентрация зависит от того, как субъект ранее отреагировал на пробные ингаляции.

Изучая эту статью, мы смогли найти только одно подходящее исследование – это статья, опубликованная в 2009 году группой британских и китайских исследователей.В документе показано, что у мышей, которым в течение двух часов давали смесь газов, содержащих 70% ксенона, через 24 часа в организме было вдвое больше HIF1A и EPO.

Для начала, это открытие не означает, что такой же результат будет наблюдаться у здоровых людей, и такие исследования на спортсменах никогда не разрешается проводить. Большинство исследований ЭПО, как правило, проводится на больных пациентах, которым необходим ЭПО в качестве терапевтического лекарства, и дозы, используемые в таком клиническом контексте, как правило, намного больше, чем предполагаемые дозы, используемые в таких видах спорта, как езда на велосипеде.

Во-вторых, взаимосвязь между уровнями ЭПО (особенно при внешнем введении) у людей и спортивными результатами еще не решена. Существующие исследования еще не исключили эффект плацебо, особенно в низких дозах, которые, как сообщается, используются в современном велоспорте. Таким образом, даже если результаты исследования 2009 года будут воспроизведены на людях, неясно, как это повлияет на спортивные результаты.

Применение ксенона в велоспорте

Как уже упоминалось, неясно, может ли ксенон улучшить работу велосипедистов.Но если предположить, что EPO может творить предполагаемые чудеса производительности, нет причин, по которым ксенон мог бы не делать то же самое.

Кроме того, исходя из того, что мы знаем о газе ксенон и EPO, газ ксенон, вероятно, будет намного безопаснее (хотя и намного дороже) в использовании. Но может быть очень практическое ограничение на использование газа ксенона для езды на велосипеде – немного менее громоздко носить с собой небольшой предварительно загруженный шприц EPO и не вызывать подозрений, чем таскать с собой огромный баллон с газом ксеноном. .

Наше исследование показывает, что об использовании ксенона пока что сообщалось только у российских спортсменов, но неясно, относится ли это к российским велосипедистам или нет.

CyclingTips обратилась к трем российским велосипедистам, выступавшим за свою страну на Олимпийских играх в последние годы: Александру Колобневу, бронзовому призеру шоссейных гонок на Олимпийских играх 2008 года в Пекине; Михаил Игнатьев, золотой призер Олимпиады 2004 года в Афинах в гонке по очкам; и Евгений Петров, выступавший за Россию в автогонке в Афинах.Пресс-службы команд гонщиков (Катюша для первых двух и Тинькофф-Саксо для Петрова) сказали нам, что гонщики не заинтересованы отвечать на наши вопросы.

Параграф на сайте MedXenon – марки ксенон-газовой смеси, производимой и реализуемой ЗАО «Атом-Мед Центр». Этот абзац был переведен с помощью Google Translate.

На прошлой неделе главный врач Garmin-Sharp Прентис Штеффен сообщил Cycling News, что команда, в которой он когда-то работал, подумывала о том, чтобы дать ксенон гонщикам, но отказалась от этого:

Честно говоря, мы изучали ксенон, но у нас были некоторые опасения по этому поводу, и мы в конечном итоге решили не использовать его.На самом деле нет ничего хорошего с точки зрения безопасности или спортивного роста, и тогда вы добавляете этические соображения. Я лично считаю, что это переходит черту и что это неэтично, поэтому мы решили не преследовать его. Мы пытались придумать, в чем будут заключаться положительные стороны, но это чистая спекуляция, потому что по этому поводу нет исследований.

Мало что известно о том, используется ли ксенон велосипедистами.

Законность и этика приема ксенона

Искусственное введение ЭПО или прием таких веществ, как стабилизаторы HIF, могут быть запрещены ВАДА, но тренировка на высоте или палатки для гипоксических тренировок имеют такое же влияние на ЭПО и не запрещены.В настоящее время в антидопинговом кодексе ВАДА нет ничего, что конкретно запрещало бы использование ксенона профессиональными спортсменами. Но должно быть?

Возможно, случай с другим веществом «серой зоны», инсулиноподобным фактором роста 1 (или IGF-1), может помочь нам понять загадку ксенона.

IGF-1 – это белок, который содержится в коровьем молоке и пантах оленей и используется в традиционной медицине в качестве тонизирующего средства для повышения иммунитета. Хотя коровье молоко и оленьи рога сами по себе не запрещены, IGF-1 запрещен.

Письмо правительства России в ЗАО «Атом-Мед Центр» об официальном одобрении применения ксенона для спортсменов.

Игрок в гольф Виджай Сингх недавно был вовлечен в PGA Tour (и WADA) по вопросу IGF-1, когда он признался, что использовал «натуральный спрей» из оленьих рогов. Хотя Сингх изначально был отстранен за употребление запрещенного вещества, турне отказались от обвинений против него, вероятно, под влиянием того факта, что было бы трудно определить, какое количество IGF-1 в системе Сингха могло быть получено из рогов оленя, а не из рогов. потребление молока, обычного напитка.

Как и IGF-1, газообразный ксенон встречается в окружающей среде. И учитывая, что ВАДА определило, что IGF-1 не должен быть запрещен, должен ли быть ксенон?

Раздел S-0 Запрещенного списка веществ и методов ВАДА запрещает любые вещества, которые не были одобрены для использования человеком. Учитывая, что газ ксенон использовался в клинической практике в течение десятилетий, раздел S-0, по-видимому, не может применяться для запрета ксенона. Другая возможная часть списка ВАДА, которая может быть использована для запрета ксенона, – это раздел M1-2, который запрещает следующее:

Искусственное усиление поглощения, транспорта или доставки кислорода, включая, помимо прочего, перфторхимические вещества, эфапроксирал (RSR13) и продукты модифицированного гемоглобина (например,грамм. кровезаменители на основе гемоглобина, микрокапсулированные продукты гемоглобина), за исключением дополнительного кислорода.

Поскольку газообразный ксенон конкретно не указан, то, если необходимо использовать раздел M1-2 запрещенного списка, было бы непоследовательно разрешать использование высотных или «гипоксических» палаток (которые имитируют большую высоту для стимуляции производства красных кровяных телец). Кроме того, интерпретация таких юридических сводов может быть оспорена в Спортивном арбитражном суде (CAS).

Немецкое антидопинговое агентство недавно проиграло дело на таких основаниях, когда запрет на обработку крови ультрафиолетовым светом, который, по мнению некоторых людей, затрудняет обнаружение допинга EPO, был оспорен в CAS.Если рассматривать случай CAS об УФ-свете и случай IGF-1 для Виджая Сингха, можно сделать вывод о двух вещах.

Во-первых, для того, чтобы ВАДА могло успешно возбудить судебное преследование за нарушение антидопинговых правил в отношении ксенонового газа в CAS, CAS должна быть «комфортно удовлетворена» тем, что процедура научно доказана для увеличения переноса кислорода. Как обсуждалось выше, настоящие научные данные о влиянии газообразного ксенона на перенос кислорода в лучшем случае неубедительны.

Во-вторых, как и IGF-1, газообразный ксенон присутствует повсеместно (в воздухе вокруг нас), он не используется и не производится организмом, он проходит через клеточные мембраны и свободно обменивается между кровью и тканями.Большая часть газа ксенона, который попадает в кровоток при однократном вдохе, возвращается в легкие и выдыхается после однократного прохождения через периферическое кровообращение.

Аппарат, используемый для подачи ксенона спортсменам, как указано в документе Российского государственного научно-исследовательского института Министерства обороны от 2010 года.

Исходя из обоснования, использованного ВАДА при определении статуса Виджая Сингха и спрея IGF-1 из оленьих рогов, ВАДА, таким образом, будет иметь бремя доказательства в CAS, чтобы показать, что спортсмен, предположительно применивший ксенон, получил от этого пользу. .Это предполагает, что концентрация газообразного ксенона может быть даже обнаружена в организме спортсмена в первую очередь.

Может ли это быть забанено ВАДА?

Итак, если газообразный ксенон в настоящее время не указан в разделах S-0 или M1-2 Списка ВАДА, следует ли его включать в запрещенный список как конкретное вещество и / или метод? Для включения газообразного ксенона ВАДА должно (теоретически) показать, что газ ксенон соответствует двум из трех следующих критериев:

1. Он оказывает неблагоприятное воздействие на здоровье
2.Обладает эффектами повышения производительности.
3. Это противоречит спортивному духу.

Учитывая, что газообразный ксенон обладает защитными свойствами, учитывая, что он имеет очень хороший профиль безопасности, и учитывая, что он рекламируется как новый рубеж в лечении болезни Паркинсона, любые потенциальные неблагоприятные последствия для здоровья могут быть незначительными по сравнению с его полезными эффектами. И вопрос о том, влияет ли ксенон на улучшение характеристик, все еще остается нерешенным. С другой стороны, это никогда не мешало ВАДА включать вещества только на основе их потенциала для повышения производительности.Возьмем, к примеру, предыдущие запреты на терапевтические лекарства от астмы.

Но противоречит ли это критерию духа спорта? Если гипоксические палатки не запрещены ВАДА и газ ксенон потенциально может работать через один и тот же физиологический механизм, то утверждение, что использование ксенона противоречит спортивному духу, будет разумно расценено как противоречивое.

Так или иначе, WADA теперь определенно знает об использовании ксенона и загадке, которую он представляет для борьбы с допингом. Бывший президент ВАДА Дик Паунд однозначно интерпретировал использование ксенона элитными спортсменами: «Давайте осознаем, без сомнения, что это допинг, и в этом процессе невозможно сказать, что правила не ясны.”

Между тем нынешний президент WADA Крейг Риди заявил, что вопрос ксенона будет рассмотрен на следующем заседании WADA. Мы с нетерпением ждем их решения.

Авторы выражают большое «спасибо» Владимиру Цырлину за неоценимую помощь в переводе документов с русского на английский для нас.

Об авторах

Доктор Бен Кох – спортивный врач с докторской степенью по стратификации медицинского риска в контексте использования традиционной, дополнительной и альтернативной медицины (CAM) в спорте высшего уровня.Его исследование также сосредоточено на юридических последствиях и на том, как руководящие принципы в рамках кодекса ВАДА могут сбивать с толку спортсменов на местах, и насколько непреднамеренный допинговый риск выше, чем это признано в литературе. Д-р Кох также имеет аспирантуру по психологии и получает степень в области права.

Доктор Кох ранее был спортсменом высокого уровня, и ему предлагали многочисленные спортивные стипендии. Первоначально он обучался как хирург-ортопед, но его последующий опыт в области экстренной медицины и спортивной медицины в сочетании с его культурным происхождением и знакомством с CAM предоставил ему инструменты для продолжения его исследовательской страсти в области, где спорт элитного уровня, медицинские риски, использование аллопатических препаратов медицина и САМ пересекаются.

Мэтт де Ниф – редактор CyclingTips. Вы можете узнать больше о Мэтте и его биографии здесь.

Дополнительная литература:

Отраслевые аналитики

только что повысили прогноз выручки Xenon Pharmaceuticals Inc. (NASDAQ: XENE) на 6,4%

Акционеры Xenon Pharmaceuticals Inc. (NASDAQ: XENE) сегодня будут иметь повод для улыбки, когда аналитики сделают существенные улучшения. прогнозы на год. Согласно консенсус-прогнозу, выручка выросла, и теперь их мнение о перспективах бизнеса компании явно более оптимистично.

После обновления семь аналитиков Xenon Pharmaceuticals пришли к выводу, что выручка в 2021 году составит 27 млн ​​долларов США, что будет отражать неприятное снижение продаж на 8,7% по сравнению с прошлым годом. Предполагается, что убытки вырастут на 48% до 1,51 доллара на акцию. Тем не менее, до последних оценок аналитики прогнозировали выручку в размере 25 млн долларов США и убытки в размере 1,49 доллара США на акцию в 2021 году. Таким образом, похоже, что в этом обновленном консенсусе не произошло серьезных изменений в настроениях, хотя аналитики сделали небольшие изменения. рост прогнозов доходов.

См. Наш последний анализ по Xenon Pharmaceuticals

NasdaqGM: XENE Earnings and Revenue Growth 13 мая 2021 г.

Конечно, еще один способ взглянуть на эти прогнозы – это сопоставить их с контекстом самой отрасли. Мы хотели бы подчеркнуть, что ожидается обратный рост продаж с прогнозируемым снижением выручки в годовом исчислении на 11% до конца 2021 года. Это заметное изменение по сравнению с историческим ростом в 52% за последние пять лет. Сравните это с нашими данными, которые говорят о том, что ожидается, что выручка других компаний той же отрасли в совокупности будет расти на 14% в год.Совершенно очевидно, что доходы Xenon Pharmaceuticals, как ожидается, будут значительно хуже, чем у отрасли в целом.

Итог

Основным моментом для нас стало то, что консенсус снизил предполагаемые убытки в этом году, что, возможно, свидетельствует о постепенном движении Xenon Pharmaceuticals к прибыльности. Приятно то, что аналитики также повысили свои оценки доходов, и их прогнозы предполагают, что бизнес будет расти медленнее, чем рынок в целом.Учитывая, что аналитики, похоже, ожидают существенного улучшения воронки продаж, возможно, сейчас самое подходящее время, чтобы еще раз взглянуть на Xenon Pharmaceuticals.

Даже в этом случае более долгосрочная траектория бизнеса гораздо более важна для создания стоимости для акционеров. В Simply Wall St у нас есть полный спектр аналитических оценок для Xenon Pharmaceuticals на период до 2025 года, и вы можете бесплатно просмотреть их на нашей платформе здесь.

Еще один способ поиска интересных компаний, которые могут быть , достигнув точки перегиба позволяет отслеживать, покупает ли руководство или продает его, с помощью нашего бесплатного списка растущих компаний, которые покупают инсайдеры.

При торговле Xenon Pharmaceuticals или любыми другими инвестициями используйте платформу, которую многие считают воротами профессионалов на мировой рынок, Interactive Brokers. Вы получаете самую дешевую * торговлю акциями, опционами, фьючерсами, валютой, облигациями и фондами по всему миру с единого интегрированного счета. Promoted

Эта статья Simply Wall St носит общий характер. Он не является рекомендацией покупать или продавать какие-либо акции и не принимает во внимание ваши цели или ваше финансовое положение.Мы стремимся предоставить вам долгосрочный сфокусированный анализ, основанный на фундаментальных данных. Обратите внимание, что наш анализ может не учитывать последние объявления компаний, чувствительных к ценам, или качественные материалы. Simply Wall St не имеет позиций ни в каких упомянутых акциях.
* Interactive Brokers признано самым дешевым брокером по версии StockBrokers.com Ежегодный онлайн-обзор за 2020 год

Хотите оставить отзыв об этой статье? Обеспокоены содержанием? Свяжитесь с нами напрямую . Вы также можете написать по электронной почте редакции (at) simplewallst.com.

Обзор Xenon Racer PS4 – EIP Gaming

Тип контента: Обзоры игр
Дата: 15 апреля 2019 г.

Xenon Racer – это футуристический аркадный автогонщик, доступный в розничных магазинах и для загрузки в PlayStation Store для PS4. 3DClouds.it имеет опыт работы в гоночном жанре, поскольку они совместно с Milestone разработали графические ресурсы для Ducati Challenge, MotoGP, Ride, Sebastian Loeb Rally, Valentino Rossi: The Game и других; состоящий из бывших талантов разработчиков из Milestone и Ovosonico.Сможет ли 3DClouds.it создать лучшего футуристического автогонщика со времен ретро-эпохи PS1 Motorhead?

Начальная сцена представляет собой сцену гонок, поскольку Всемирная лига прототипов (WPL) информирует производителей в 2029 году, что чемпионат Xenon Racing Championship – это гоночная серия будущего с участием автомобилей с магнитной левитацией с 2031 года. соревновательный, но неофициальный чемпионат, созданный производителями для подготовки и тестирования усовершенствованной системы рекуперации энергии (ERS) и технологии искусственного интеллекта, наряду с беспрецедентным аэродинамическим дизайном автомобиля.Геймплей начинается с обучения, демонстрирующего основы, такие как ускорение, рулевое управление, торможение и движение задним ходом, переключение углов камеры и многое другое, в то время как расширенное руководство фокусируется на дрифте и ERS.

Режим Xenon Racing Championship включает в себя десятки соревнований, в которых соревнуются 7 автомобилей в гонках; начиная с турнира WGT из трех гонок, требующего финиша пятым, перед тем, как разблокировать событие из двух гонок под названием «Первая гонка WGTE», цель которого – занять третье место, чтобы разблокировать следующее событие.

Режим

Fast Race позволяет игроку выбирать от одной до пяти специально выбранных или случайных гонок, а также выбирать разблокированные места и трассы для любого места от одного до десяти кругов, погодные условия и автомобиль в индивидуальной одиночной гонке или чемпионате против 7 AI контролируемые противники. Между тем, режим Edge включает в себя временную атаку, которая заставляет игрока установить самое быстрое время круга в пределах одного круга, в то время как атака контрольной точки ставит задачу игроку выжить в течение трех кругов, достигнув следующей контрольной точки до истечения времени, наряду с устранением, при котором уничтожаются 7 автомобилей. от гонки в течение пяти кругов до тех пор, пока не останется только один участник, и свободный режим, который позволяет игроку тренироваться на треке на протяжении бесконечного количества кругов; предоставляя возможность экспериментировать с гоночными трассами, пытаясь сократить лучшее время круга игрока.Тем не менее, события, сфокусированные на времени в режиме Edge, особенно атака на время и атака на контрольную точку, имеют особенно строгое время или определенную площадь, которую нужно преодолеть за время, которое может быть успешно достигнуто только при вождении намного более быстрой машины; поэтому для каждой машины было бы лучше иметь определенное время или изменение положения контрольной точки во время атаки по времени и атаки на контрольную точку соответственно, что было бы достижимо при поддержании очень хорошего темпа.

Дизайн автомобиля уникален, поскольку автомобили имеют футуристический дизайн, но при этом используются на четырех шинах, а не на антигравитационных машинах, которые можно найти у большинства футуристических гонщиков.Аэродинамический дизайн; автомобили представляют собой смесь Indycar, Le Mans и того, как машина Формулы-1 могла бы выглядеть, если бы не было ограничений в аэродинамике и мощности двигателя. Всего в игре 18 машин, хотя с самого начала доступны только две машины, а остальные машины нужно разблокировать после победы в чемпионатах. Существует четыре категории автомобилей, включая нормальные, рабочие характеристики, нормальные GT и рабочие характеристики GT, в то время как каждый автомобиль имеет 7 уникальных характеристик, включая максимальную скорость, ускорение, дрейф, управляемость, скорость перезарядки ускорения ERS, продолжительность ускорения ERS и мощность ускорения ERS.

Тем не менее, гараж – это то место, где на самом деле оживает индивидуальная настройка автомобиля, поскольку у игрока есть дополнительная мотивация для достижения успеха, чтобы разблокировать улучшения автомобилей и косметический дизайн. Модернизация автомобилей включает в себя полдюжины типов колес, три передних крыла, три средних крыла и три конструкции заднего крыла, которые индивидуально увеличивают или уменьшают качество максимальной скорости, ускорения, дрейфа и управляемости, в то время как есть три конструкции компонентов ERS, которые увеличивают или уменьшают качество скорости перезарядки ERS boost, длительность ускорения ERS и мощность ускорения ERS.Между тем, визуальный аспект индивидуальной настройки автомобиля осуществляется в течение пяти ливрей кузова автомобиля, трех наборов цветов окраски и поверхностей в категории масок для тела. Каждый тип колеса имеет множество цветов на выбор как для поверхности шины, так и для логотипа, в то время как на ободах шин представлен различный дизайн для центра колеса, за которым следует цвет для центра обода колеса, цвет для внутреннего дизайна колеса. обод, цвет для колесной гайки и 7 типов поверхности, которые делают внутреннюю часть колеса более или менее блестящей и отражающей его окружение, рядом с окном автомобиля есть столько цветов на выбор и 7 типов поверхности.

Управляемость

на самом деле напоминает управляемость Ridge Racer, поскольку дрифтинг играет огромную роль на вашем круге по скорости круга, поскольку дрифтинг является самым большим фактором, способствующим зарядке аккумулятора до включения ERS, хотя здесь также есть несколько модулей для подзарядки аккумуляторов ERS и там на ходу. Однако, если игрок слишком рано или слишком поздно начинает дрейфовать в поворот, то есть хороший шанс врезаться в ограждение дороги; в результате не только на мгновение значительно снижается ваше ускорение, но и наносится ущерб вашей машине, что приводит к возрождению вашего автомобиля на трассе после достижения 100% урона.Возрождение на трассе после достижения 100% урона может быть довольно неприятным, так как количество времени, необходимое для возрождения, кажется несбалансированным из-за времени и земли, потерянных вашими гоночными соперниками в этом процессе. Одна особая область обращения, которая потенциально может предотвратить столкновение вашего автомобиля с путевыми ограждениями на высокой скорости, – это ручной тормоз, который значительно замедляет автомобиль; идеально подходит для крутых углов, по которым сложно проехать.

Конструкция путей весьма разнообразна, так как есть 7 локаций, включая США, Японию, Дубай и другие, кроме того, каждое из которых состоит из трех треков на локацию с прямым и обратным расположением треков для каждого трека, хотя сразу доступны только два местоположения, а остальные пять. локации открываются после победы в чемпионатах.Трассы напоминают трассы Формулы E в том смысле, что они больше напоминают уличные трассы, чем классические трассы для автоспорта, такие как Спа и Монца, хотя большинство новых трасс в автоспорте, как правило, являются уличными трассами. так что это точное отражение современных тенденций в дизайне треков в автоспорте.

Xenon Racer имеет четыре состояния трассы для каждой трассы, включая солнечное небо, ночное время с освещением, расположенным вокруг трассы, аналогичное GP Singapore, солнечное с небольшими облачностями и облачность с дождем, который выпал на трассе и частично высох перед стартом гонка, оставляющая лужи на поверхности трассы.Однако было бы неплохо увидеть звезды на ночном небе и чтобы пошел дождь во время дневных и ночных гонок.

Есть пять превосходно расположенных ракурсов камеры, включая перспективу от первого лица с передней части автомобиля без отображения какого-либо кузова, вид от первого лица из капота и еще один ракурс камеры от первого лица немного дальше от обзора капота, в то время как Есть также две перспективы от третьего лица, расположенные рядом с задним крылом и дальше назад. Все три угла камеры от первого лица можно поворачивать, чтобы смотреть по диагонали влево или вправо и позади автомобиля, в то время как оба угла камеры от третьего лица можно поворачивать на полные 360 градусов, чтобы обнаруживать потенциальные попытки обгона со стороны ближайших противостоящих автомобилей.Тем не менее, здесь нет перемотки в середине гонки или повторов после гонки, в то время как вид из кабины, демонстрирующий дизайн интерьера автомобиля и угол обзора камеры вертолета сверху над трассой после действия со звуковым эффектом вертолета в аудиомиксе, будет иметь Сделано для дальнейшего удивительного игрового процесса ракурсами.

Режим фото доступен из меню паузы; позволяя вам более детально наблюдать за гонками на переднем плане и на трассе. Фоторежим – действительно замечательная функция; позволяет свободно размещать камеру в непосредственной близости от места проведения гонок, включая обширную настройку изображений, таких как панорамирование, высота камеры, увеличение или уменьшение масштаба, а также возможность регулировки ползунков в зависимости от фокусного расстояния, расстояния фокусировки, диафрагмы и поворота ; насыщенность, контраст и гамма; блики линз, хроматические аберрации и поседение; выдержка, виньетирование и зернистость; а также 12 логотипов и 5 рамок в полностью захватывающей среде, которая идеально гармонирует с функцией общего доступа PS4.

Xenon Racer – это футуристический гонщик, который Vita требовал для родного порта, поскольку последним футуристическим гонщиком на Vita на самом деле был Wipeout 2048, выпущенный в день запуска Vita, хотя Xenon Racer не будет выпускаться на Vita, но, по крайней мере, удаленная игра – утешение. Производительность удаленного воспроизведения Xenon Racer довольно хороша, поскольку графика, звук и общая производительность поддерживают качество версии для PS4. Однако дистанционное управление воспроизведением вообще не было оптимизировано, что привело к необходимости ускоряться и дрейфовать, используя верхний правый угол задней сенсорной панели, в то время как торможение отображается в верхнем левом углу задней сенсорной панели.Было бы намного лучше, если бы игроки могли переназначить свои элементы управления, так как ускорение и дрейф будут отображаться на R, а торможение – на L, что вполне реально, учитывая тот факт, что R1 вообще не используется, а L1 используется только для того, чтобы смотреть назад. ваш автомобиль, что на самом деле также можно сделать, переместив правый аналоговый джойстик назад. Во время дистанционной игры можно выигрывать гонки, но для этого потребуется некоторое ознакомление с задней сенсорной панелью в схеме дистанционного управления.

Элементы управления соответствующим образом сопоставлены с контроллером DualShock 4 со схемой управления, состоящей из удерживания R2 для ускорения; нажатие L2 для торможения или реверса; отпускание R2 при ускорении с последующим быстрым удержанием R2 снова для дрейфа; нажатие O для включения усиления ERS; нажатие X для использования ручного тормоза; нажатие на треугольник для изменения угла камеры; нажмите L1, чтобы оглянуться за свою машину; изменение направления левого аналогового джойстика для управления автомобилем; изменение направления правого аналогового джойстика для панорамирования камеры; нажатие кнопки параметров для отображения меню паузы; и нажав кнопку «Поделиться», вы попадете в меню функций совместного использования.Нажатие на сенсорную панель возрождает вашу машину в центре трассы, а вибрация возникает, когда в данный момент задействована система ERS, когда ваш автомобиль столкнулся с машиной противника или при врезании в путевой барьер. Не существует реализации световой панели, которая могла бы создать альтернативный HUD для здоровья вашей машины или отображать цветовую схему вашей команды. Xenon Racer предлагает поддержку рулевого колеса для Logitech G25, G29 и G920, Thrustmaster TX Racing, T300 RS, T150 RS, T80, TMX Force, T-GT, Ferrari 458 и TS-XW, а также Fanatec ClubSport и CSL Elite.

Графически Xenon Racer эффективно использует Unreal Engine 4 для создания детализированных аэродинамически управляемых и ориентированных на команду ливрей для каждой модели автомобиля, в то время как трассы огромны по размеру путевых структур, зданий и рекламных щитов. В другом месте есть тонкие графические штрихи, такие как искры, которые разлетаются при контакте с другим автомобилем или бортовым барьером, в то время как стильное футуристическое зеркало заднего вида отображается способом, напоминающим неоновый эквалайзер, сформированный по ширине гусеницы и близлежащих автомобилей.Поддержка PS4 Pro включает режим производительности, обеспечивающий стабильные 60 кадров в секунду, в то время как режим качества обеспечивает стабильные 30 кадров в секунду, хотя и с превосходными настройками графики, хотя и режим производительности, и режим качества отображаются с разрешением 4K.

Презентация

Xenon Racer солидна с отличным пользовательским интерфейсом в различных меню, таких как главное меню, меню чемпионата, меню режима быстрой гонки, меню пограничного режима, многопользовательские меню с разделенным экраном, многопользовательские онлайн-меню, меню настройки автомобиля, меню настроек и игровой процесс. меню с поддержкой навигации с помощью левого аналогового джойстика, навигационной панели и лицевых кнопок, в то время как камеру можно панорамировать вокруг вашего последнего выбранного автомобиля с помощью правого аналогового джойстика, хотя это не включает поддержку навигации с помощью сенсорной панели.Фоны меню фокусируются на панорамировании и повороте камеры под выбранным вами автомобилем в качестве фокусной точки выставочного зала. Между тем на загрузочных экранах представлены факты и советы по автомобилям, включению ERS и управлению автомобилями.

Женский голос за кадром представляет чемпионат, когда батарея ERS частично или полностью заряжен, и предупреждение о большом количестве повреждений, нанесенных машине игрока, в то время как мужской голос за кадром представляет гоночные события и анализирует обгоны во время гонок, столкновений. и производительность игрока в стиле Ridge Racer.Звуковые эффекты включают в себя автомобиль игрока и автомобили противников, ускоряющиеся, дрейфующие, включающие ERS и врезавшиеся в дорожные преграды или противников, в то время как есть атмосфера в виде атмосферной толпы, а также саундтрек, который отражает многих футуристических гонщиков, в основном сосредоточенных на техно и электронике. Музыка. Реализации динамика DualShock 4 не существует, хотя она могла бы реально воспроизводить звуковые эффекты, связанные с ERS.

Список трофеев включает 31 трофей, из них 14 бронзовых трофеев, 10 серебряных трофеев, 6 золотых трофеев и 1 платиновый трофей.Более простые трофеи включают бронзовый трофей, два серебряных трофея и один золотой трофей для естественной игры в течение 2, 4, 8 и 10 часов соответственно, хотя временная атака и свободный режим не включены в общее количество игрового времени. Более сложные трофеи включают золотой трофей «Быстрее, чем ветер» за получение золота на всех треках временной атаки; серебряный трофей Кабинета за победу во всех гонках с атакой на контрольно-пропускных пунктах; и золотой трофей Xenon Gives You Wings за победу в финальном испытании. Есть 9 сетевых многопользовательских трофеев, включая бронзовый трофей и золотой трофей за победу в одной и 20 онлайн-гонках соответственно; бронзовый трофей и серебряный трофей за победу в онлайн-чемпионате на 3 и 5 гонок соответственно; и 3 бронзовых трофея, 1 серебряный трофей и 1 золотой трофей за достижение онлайн-ранга 4, 5, 7, 9 и 10.Подсчитано, что в зависимости от навыков и хорошего руководства по трофеям, дающего несколько полезных советов, потребуется от 20 до 30 часов, чтобы стать платиновым призером.

Существует три уровня сложности, включая легкий, средний и сложный, с основными отличиями в увеличенной скорости A.I. контролируемые автомобили, которые, скорее всего, приведут к тому, что игрок финиширует вторым или ниже, несмотря на то, что он совершит только одну ошибку в почти идеальном темпе гонки. Дополнительный уровень сложности представляет собой рейтинг от одной до пяти звезд, демонстрирующий техническую составляющую трассы.

Многопользовательский режим с разделенным экраном поддерживает двух игроков с возможностью игры 1 на 1 или с четырьмя ИИ. управляемые машины в одиночных гонках или настраиваемые чемпионаты от двух до пяти гонок. Высокая производительность и большая часть графической точности поддерживаются в одиночной игре, включая обнаружение столкновений между автомобилями со всех пяти углов одиночной камеры, несмотря на то, что между двумя экранами одновременно видны до 12 автомобилей. Однако было бы неплохо иметь подиум после каждой гонки и в конце индивидуального чемпионата в честь того, что один или оба игрока финишируют в гонке или чемпионате на трех верхних позициях.

Многопользовательская онлайн-игра поддерживает от 2 до 8 игроков с ИИ. управляемые автомобили дополняют сетку настраиваемыми чемпионатами по трем и пяти гонкам. Сетевой мультиплеер сохраняет высокую скорость одиночной игры, хотя и без обнаружения столкновений между машинами.

Реиграбельность

Xenon Racer проистекает из чемпионата в стиле карьерного режима, одиночных гонок или чемпионатов в режиме быстрой гонки, а также типов событий с гонками на время и элиминатора в пограничном режиме, которые проходят в 7 локациях, каждая из которых содержит три трека в прямом и обратном направлениях, поскольку имеется 18 автомобилей с уникальными атрибуты на выбор после их разблокировки.В другом месте есть три уровня сложности, относящиеся к AI. управляемые автомобили, в то время как есть многопользовательская игра на разделенном экране для двух игроков и многопользовательская онлайн-игра для 2-8 игроков с опцией A.I. управляемые автомобили, чтобы пройти поле как в локальном, так и в онлайн-мультиплеере. Разработчик 3DClouds.it и издатель Soedesco подтвердили, что Xenon Racer будет поддерживаться бесплатным контентом после запуска, включая две новые локации, две новые команды и больше автомобилей.

Анализ
• Название: Xenon Racer
• Разработчик: 3DClouds.it
• Издатель: Soedesco
• Система: PS4
• Формат: Blu-Ray Disc / PSN Скачать
• Cross-Buy: Нет
• Cross-Play: Нет
• Игроки: 1-2 (Соревновательный многопользовательский режим с разделенным экраном) / 2-8 (многопользовательская онлайн-игра)
• Требуемое пространство на жестком диске: 6,31 ГБ (версия 1.03)

Блог

Hop: Xenon

Ксенон Благородный газ


Ксенон – один из тяжелых благородных газов.
Благородные газы – это оранжевый столбец справа от таблицы Менделеева.Они химически инертны. Это означает, что они не вызывают коррозии. Это упрощает их хранение и использование.

Низкая энергия ионизации

Согласно этому графику из Википедии, ксенон имеет более низкую энергию ионизации, чем более легкие благородные газы.


Энергия ионизации ксенона (Xe) составляет 1170,4 кДж / моль. Ионизация криптона (Kr) составляет 1350,8 кДж / моль. Похоже, разница примерно в 15%, не так ли?

Но моль наиболее распространенного изотопа ксенона составляет 131,3 грамма, а моль криптона – 82.8 грамм. Таким образом, для ионизации грамма криптона требуется 181% или почти вдвое больше сока.

Аналогично, для ионизации грамма аргона требуется почти в 4,5 раза больше сока.

Реакционная масса должна быть ионизирована, прежде чем ее можно будет толкать магнитным полем. Ксенону требуется меньше сока для ионизации. Таким образом, больше энергии ионного двигателя можно использовать для передачи скорости выхлопа реакционной массе.

Большие атомы, молярный вес

Низкий молярный вес обеспечивает хороший ISP, но плохую тягу.А жалкая тяга – это ахиллесова пята холловских двигателей и других ионных двигателей. Атомный вес ксенона 131,29 (см. Таблицу Менделеева вверху страницы).

Крошечные молекулы водорода известны тем, что просачиваются через самые плотные уплотнения. Большим атомам труднее протиснуться через плотные уплотнения. Большие огромные атомы, такие как ксенон, легче хранить.

При температуре около 160 К ксенон представляет собой жидкость с плотностью около 3 граммов на кубический сантиметр. Напротив, кислород жидкий при температуре ниже 90 К и плотности 1.1. Таким образом, ксенон является гораздо более мягким криогеном, чем кислород, и имеет более чем двойную (почти тройную) плотность.

Изобилие

Обычная атмосфера составляет 1,2 кг / м 3 , а ксенон составляет около 5,9 кг / м 3 при том же давлении. Ксенон примерно в 4,8 раза плотнее обычного воздуха.

По объему земная атмосфера содержит 0,0000087% ксенона. 4,8 * .000000087 = 4,2e-7. Масса атмосферы Земли оценивается в 5e18 кг. По моим арифметическим подсчетам, в земной атмосфере содержится около 2–12 кг ксенона.То есть около 2 миллиардов тонн.

Стр. 29 предложения по поиску астероидов Кека требует 12,9 тонны ксенона. Скептики пришли в ужас: «13 тонн – это почти треть мирового производства ксенона в год! Это вызовет дефицит». Что ж, производство определяется спросом. С 2 миллиардами тонн в нашей атмосфере 13 тонн – это капля в море. Мы выбрасываем много ксенона, когда сжижаем кислород и азот из атмосферы.

Фактически увеличение производства ксенона приведет к экономии за счет масштаба и, вероятно, приведет к падению цен до .TildalWave приводит такой аргумент в своем ответе Space Stack Exchange на вопрос «Сколько стоит заполнить ионный двигатель ксеноном для двигательной установки космического корабля?» TildalWave утверждает, что увеличение производства может привести к цене 250 000 долларов за тонну. Это примерно четырехкратное снижение текущей рыночной цены на 1,2 миллиона долларов за тонну.

Радон

Если вы изучили таблицу Менделеева и таблицы ионизации, приведенные выше, вы могли заметить, что есть более тяжелый благородный газ с еще меньшей энергией ионизации: Радон a.к.а. Rn. Радон радиоактивен. Радон 222, самый стабильный изотоп, имеет период полураспада менее 4 дней. Если я правильно посчитаю нули на странице радона, наша атмосфера состоит из 1e-19% радона – чего можно ожидать от чего-то с таким коротким периодом полураспада. Помимо того, что он редко, его долго не хранят.

Скотт Мэнли сделал отличный ролик по ксенону.

Где ксенон превосходит

Отлично подходит для перемещения между гелиоцентрическими орбитами

Ионные двигатели могут достигать скорости истечения от 10 до 80 км / с, 30 км / с – типичная скорость истечения.Это примерно в 7 раз лучше, чем у бидвигательного двигателя водород / кислород, который развивает скорость 4,4 км / с. Но, как уже упоминалось, ионная тяга и ускорение невелики. Требуется очень много времени, чтобы получить дельту V. Чтобы получить хорошее ускорение, транспортному средству с ионным двигателем нужна хорошая альфа. На мой взгляд, скорость 1 миллиметр в секунду 2 вполне возможна с источниками питания ближайшего будущего.

Если ускорение транспортного средства составляет здоровую часть местного гравитационного поля, ускорения напоминают импульсные ожоги при входе или выходе на эллиптическую переходную орбиту.Но если ускорение составляет крошечную долю местного гравитационного поля, путь представляет собой медленную спираль.


Расстояние от Земли до Солнца, сила тяжести Солнца составляет около 6 миллиметров в секунду 2 . На Марсе гравитация Солнца составляет около 2,5 мм / с 2 , а в поясе астероидов 1 мм / с 2 или меньше. Ионные двигатели подходят для перемещения между гелиоцентрическими орбитами, особенно когда вы добираетесь до Марса и Главного пояса.

Отстой для лазания в планетарных гравитационных колодцах и из них

На высоте 300 км местное гравитационное поле Земли составляет около 9000 миллиметров в секунду 2 .Примерно в 9 тысяч раз больше 1 мм / с 2 ускорение, которое может сделать правдоподобный ионный аппарат. На высоте низкой орбиты Марса сила тяжести составляет около 3400 миллиметров / сек 2 . Так что медленные постепенные спирали, а не эллиптические переходные орбиты. Также нет преимущества Oberth.

При ускорении 1 мм / сек 2 потребуется около 7 миллионов секунд (80 дней), чтобы подняться в земной гравитационный колодец или выйти из него, и около 3 миллионов секунд (35 дней) для марсианского колодца.

Изображение ионной спирали

, сделанное Марком Адлером

где ускорение двигателя составляет 1/000 от ускорения местной силы тяжести на старте.


Общее практическое правило для расчета дельты V, необходимой для спиралей с малой тягой: вычесть скорость орбиты назначения из скорости орбиты вылета.

Скорость низкой околоземной орбиты (НОО) составляет около 7,7 км / с. Но вам не нужно идти к C3 = 0, достаточно пройти через Сферу Холма Земли. Итак, около 7 км / с, чтобы набрать высоту от НОО до края земного гравитационного колодца.

Для того, чтобы добраться от Земли до 1 A.U., требуется около 5,6 км / с. гелиоцентрическая орбита к Марсу 1,52 а.е. гелиоцентрическая орбита.

Скорость низкой орбиты Марса (LMO) составляет около 3.4 км / с. Примерно 3 км / с от края Сферы холма Марса до ЖИО.

7 + 5,6 + 3 = 15,6. Всего 15,6 км / с, чтобы добраться от НОО до ЖМО.

С преимуществом Oberth, чтобы добраться от LEO до LMO, требуется около 5,6 км / с. Экономия Oberth составляет почти 10 км / с.

На 10 км / с чихать нечем, даже если скорость истечения 30 км / с. Восхождение вверх и вниз по планетарным гравитационным колодцам с ионными двигателями требует значительного дельта V, а также много времени.

Лифты и химикаты для планетных колодцев, ионные для гелиоцентрических

Итак, в своих мечтах я представляю инфраструктуру на краю планетарных гравитационных колодцев.Порты, куда прибывают и уезжают транспортные средства с ионным приводом, перемещаясь по Солнечной системе. Тогда транспортировка от края скважины вниз будет осуществляться как химическими, так и орбитальными лифтами.

Добавить комментарий

Ваш адрес email не будет опубликован.