Подшипники фаг отзывы: FAG отзывы о запчастях, страна производитель, официальный сайт

Содержание

Поставщики подшипников

Кто-то скажет – а чего мучится – надо купить подшипники производителя X, во всех магазинах навалом, продавцы говорят, что их больше всех покупают. Но вот посмотрите – сколько на улице Жигулей и сколько Феррари. Что вы выберете за одинаковые деньги?

Современная глобализация приводит к постоянным слияниям и поглощениям предприятий, в том числе, и в автомобильной отрасли. В той же Швеции – Вольво принадлежит Форду, а СААБ – Дженерал Моторс. Концерн Фольксваген – это не только Гольф и Пассат – это и Шкода и Сеат и Ауди. Продолжать можно бесконечно.

Как правило, крупные автомобильные концерны имеют общую систему снабжения. Если взять за пример VAG или Volkswagen Audi Group, то подшипники на Фольксваген, Шкоду, Ауди и пр. закупаются централизованно (не обязательно в одном месте).

Обычно компании – производители автомобилей выбирают несколько поставщиков на один узел. Широко применяется такая практика: выбирается основной поставщик, который получает 50% заказа, и несколько неосновных, имеющих, к примеру, по 25%.

Подчеркнем, что речь идет об одном узле (например переднем ступичном подшипнике). В другом узле соотношение долей поставщиков может меняться. Раз в год, иногда реже, иногда чаще, поставщики и их доля в заказе может меняться. То есть, если у вас на автомобиле подшипники фирмы ААА – значит это и есть оригинал. Однако и подшипник БББ и ВВВ и может даже ГГГ имеют право быть поставленными на машину и соответствовать тому, что идет на конвейер.

Сегодня полки магазинов полны подшипниковой продукцией различных фирм. Мы не будем касаться отечественных и китайских поделок. Расскажем о ситуации на рынке подшипников для автомобилей.

Ниже мы приведем список основных поставщиков на конвейеры производителей европейских автомобилей:

SNR – французская компания – самый крупный поставщик для европейской подшипниковой промышленности.

SKF – второй после SNR в Европе, крупнейший в мире.

FAG – ведущий германский производитель подшипников, с недавнего времени куплен компанией INA.

NSK – второй крупнейший в мире производитель подшипников, Япония.

NTN – второй по величине в Японии.

Коуо – входит в концерн Toyota, №3 в Японии.

Timken – самый большой американский производитель подшипников №1 по конической группе.

INA – не изготавливает ступичных подшипников, однако много их подшипников идет в двигатель (ролики натяжителя ремня ГРМ) и в коробку передач.

Отметим, что японские производители, как правило, поставляют в основном на конвейер и слабо представлены на рынке запчастей.

Все перечисленные компании имеют большое количество заводов по всему миру и поэтому не надо обращать внимание на страну-изготовитель. Качество везде одинаково. Кроме того, производитель подшипников размещает свой завод по производству шариковых подшипников во Франции, а конических, к примеру, в Англии. Вы не найдете, скажем, шариковых ступичных подшипников SKF, сделанных в Германии, но испанских или итальянских – сколько угодно. Если производитель допущен на конвейер, значит он прошел жесткий отбор, значит его система качества соостветствует очень строгим требованиям призводителя автомобилей. Не надо гнаться за надписью “made in Germany”. Надо покупать «имя». Того, кто гарантирует качество своей продукции, а не лепит красивые лейблы.

Многие автопроизводители требуют либо полное (т.е. нулевое) отсутствие дефектов, либо допускают один дефект на миллион, что тоже стремится к нулю. Так могут работать далеко не все. Кроме перечисленных производителей подшипников существует великое множество фирм выпускающих продукцию только для рынка запчастей.

Кроме фирм производителей в магазинах широко представлены, так называемые, «упаковщики». Это компаниии обычно не производящие подшипников, а упаковывающие их в свои коробки.

Ruville – крупный упаковщик, сотрудничающий как с лидерами так и с аутсайдерами. Проходили и румынские и польские подшипники

Optimal – польская фирма, ранее эксклюзивный дистрибьютор фирмы IRB, сегодня – упаковщик крайне некачественной продукции (Китай, Восточная Европа и т.п.). Безусловно, если к примеру на Audi 100 передний ступичный подшипник делают только SKF и FAG, то и в комплекте Optimal вы найдете этих именитых производителей.

QH – покупают у кого дешевле.

НК – упаковщик, принадлежит фирме FAG.

Corteco, Coparts, NK – эти фирмы тоже не гонятся за качеством, покупая подшипники где дешевле.

СХ – откровенный Китай.

Как правило, в ремкомплект ступичного подшипника обычно входят детали, требующие замены – болты, штифты, гайки, сальники и т.

п.

К слову, и SKF и SNR и другие тоже в той или иной степени используют в своих комплектах ступичных подшипников продукцию конкурентов. Невозможно сделать все. Однако ведущие фирмы очень тщательно относятся к выбору поставщиков и можно быть уверенным, что покупаешь оригинал.

Подшипники FAG: отзывы специалистов

Производитель FAG производит качественные изделия — подшипники, которые поставляются на конвейеры основных, проверенных компаний. Деталь ступицы передней оси или задней может пройти расстояние, которое равно около 300 тысяч километров, что не раз отмечают разработчики и возможные независимые специалисты.

 

Именно поэтому рекомендуется купить подшипники от этого производителя. А предварительно, перейдя по ссылке http://impod.ru/podshipniki-fag-kupit/ можно подобрать подшипники FAG и выбрать подходящую модель. Каждая деталь представлена в разных видах для автомобиля, поэтому можно легко выбрать лучший вариант.

Для того, чтобы окончательно убедиться в том, что подшипники FAG качественные, рекомендуется узнать отзывы клиентов.

Мнения профессионалов

Мастер по ремонту легковых автомобилей Олег из города Рязань. За небольшой опыт работы отмечаются некоторые отличительные качества подшипников компании FAG. Работа с данной компанией продолжается примерно три года и за весь период не находилось замечаний по качеству деталей и их надёжности.

Специалист по автомобилям Макар из города Сыктывкар. Нужно отметить бывшего производителя, который был под именем SKF. С ним работа продолжается уже длительное время и не возникало нареканий. Но один раз пришлось поставить подшипник FAG, а он был бракованным, поэтому пришлось выискивать замену по компании SKF. В итоге — это оказалось реальное качество, можно предложить другим данный подшипник.

Мнения сторонних специалистов

Ярослав из города Москвы. Подшипник приобретён на авто Митсубиси Лансер. Ещё около трёх месяцев назад выполнялась замена ступицы по Фаг.

При катании не возникает каких-либо проблем. Многие знакомые профессионалы по запчастям рекомендуют данного производителя.

Михаил из города Саратова ездит на автомобиле VW Golf. Автомобиль включает колеса 18-го размера, что сильно грузит ступицы, из-за этого приходится менять подшипники каждые 15 тыс. километров. Пришлось менять на FAG.

«Деталь компании FAG отличается высоким качеством по сравнению с классическими подшипниками» — сообщает разработчик и это действительно так. Рассчитан на 300 тыс. километров при нормальных условиях эксплуатации.

 

Китайские подшипники: мифы и реальность

Современный рынок подшипников представлен большим разнообразием продукции. Свои товары предлагают известные на всю планету бренды, есть менее именитые европейские изделия, отечественные, азиатские. В том числе подшипники из Китая получили широкое распространение: их легко приобрести, и часто они привлекают низкой ценой.

С китайской продукцией связаны многие предубеждения. Плохое качество, короткий срок службы, возникновение дефектов в работе оборудования из-за использования контрафактной продукции. Некоторые распространенные мифы легко развеять. В свободной продаже есть и такие товары, от приобретения которых стоит воздержаться. В этой статье мы разберемся: весь ли Китай плохой, кому стоит доверять и чего остерегаться.

Самый распространенный миф о подшипниках из Китая

Многие убеждены, что вся китайская продукция ненадежна, характеризуется низким качеством, изготавливается в условиях кустарного производства.

Реальная обстановка не так однозначна, потому что на рынке представлены различные категории китайских подшипников. Какими особенностями они обладают? Как отличить хорошие изделия от низкосортных?

Высококачественные подшипники из Китая

Есть известные на весь мир лидеры в производстве подшипников, которые открыли в Китае собственные заводы. Это NSK, Koyo, SKF, FAG и прочие. В их ответственности перед потребителем и качестве продукции никто не сомневается.

Значительное количество заводов таких крупных брендов действуют именно на территории КНР. Получается, что по стране производства изготавливаемая ими продукция — это китайские подшипники. Однако бренды используют высокоточное, часто европейское оборудование, устанавливают строгие стандарты качества, внедряют многоступенчатый контроль на производстве.

Поэтому выпускаемая «фабричным Китаем» продукция считается первоклассной. Китай в этом смысле — просто дислокация завода, а надежность и соблюдение технологических процессов гарантирует «головной» бренд.

Огромный плюс — сниженная цена, поскольку рабочая сила на китайском рынке труда дешевле. Обычно местных специалистов обучают и контролируют иностранные эксперты. Поэтому возможные нарекания к такой продукции безосновательны, а мифы о плохом качестве — ошибочны.

Подшипники китайского производства хорошего качества

Есть также менее знаменитые бренды из Индии, Малайзии, Европы, которые переносят на китайские заводы часть своего производства. Причина та же — в Китае доступнее и дешевле рабочая сила, проще наладить производственные площадки. Это снижает себестоимость и стоимость готового продукта.
Головная организация внедряет свою систему контроля качества, обеспечивает соблюдение ISO и других международных стандартов. Поэтому такая схема китайского производства подшипников выгодна для потребителей и по качеству, и по цене.

Не будем забывать, что в Китае действуют собственные компании по производству подшипников, которые стремятся заработать себе положительную репутацию. Потому следят за выпуском надежных изделий.  

Сделано в Китае: no name

Товар без маркировки: такую продукцию опасно приобретать для дальнейших производственных процессов. Поскольку это и есть тот самый некачественный и «нефабричный» Китай, который породил скверный имидж для всей китайской продукции.

Различные артели, кустарные и иногда подпольные мастерские выпускают штамповку из сырья низкого качества, которая стоит копейки и никакой надежности не гарантирует. Не стоит привлекаться низкой ценой и рассчитывать на случайное везение. Такой подшипник может испортить весь механизм или дорогостоящее оборудование.

Встречается еще и такая продукция, которая имеет поддельную маркировку. На подшипник наносится наименование известного производителя, но эксплуатационные характеристики и частый брак впоследствии выдают фальшивку.

Как застраховать себя от такой покупки? Заказывать подшипники только у проверенных поставщиков. Напомним, ООО «РАРП» — официальный дилер NSK. Гарантируем оригинальность и высокое качество этих подшипников, а также иной продукции, входящей в наш ассортимент.

Подшипник задней ступицы FAG комплект на Ланос Сенс Нексия Нубира I-II. – 713 6445 10

Описание

Подшипник задней ступицы Ланос Сенс Нексия Нубира I-II.

FAG, центральный офис в Германии, завод производитель во Вьетнаме. Цена за комплект. Комплект из двух подшипников, внутреннего и наружного, шплинта, смазки и сальника (манжета) задней ступицы.

Все подшипники на Ланос Сенс.

Магазин Запчасти ЗАЗ предлагает доставку Подшипник задней ступицы FAG с номером 713 6445 10 по всей Украине. В каталоге представлены детали от оригинального производителя General Motors и сторонних брендов. Разница между ними в цене. Мы работаем с проверенными поставщиками. Все детали подходят для ремонта и сервисного обслуживания автомобилей произведённых на Запорожском автомобилестроительном заводе с разным объемом двигателя. 

Гарантия качества на Подшипник задней ступицы FAG

  • Магазин Запчасти ЗАЗ имеет богатый опыт работы.

  • Оригинальный код 713 6445 10 полностью совпадает с каталожным номером производителя FAG.

  • Поиск деталей можно выполнить по оригинальному коду 713 6445 10.

  • Оплата производится разными способами – наличным и безналичным. Также доступна оплата на банковские карты Монобанк и ПриватБанк.

  • Доставка по Украине выполняется разными почтовыми службами. Возможен самовывоз.

Если у вас возникли вопросы относительно Подшипник задней ступицы FAG с номером 713 6445 10, свяжитесь с нашим консультантом.

Полезная информация

  • При получении заказа проверяйте комплектацию товара Подшипник задней ступицы FAG.

  • Перед монтажом запчасти проверьте оригинальный код 713 6445 10.

  • Доверяйте установку деталей компетентным специалистам.

На сайте магазина Запчасти ЗАЗ собраны все детали для ремонта автомобилей. Если не нашли нужную запчасть, свяжитесь с нашим консультантом.

Подшипники FAG: как отличить подделку

Сегодня большое количество механических конструкций невозможно представить без подшипника. Подшипник способствует вращению и передачи нагрузки от узла движения другим элементам всей конструкции.

В этой статье идет речь о подшипниках FAG, истории бренда и определения оригинальной продукции, которую вы также можете приобрести на https://uzp.net.ua/ru/brendy/fag/.

Когда началось производство подшипников FAG

Начать стоит с того, что FAG – немецкий бренд, который начал заниматься широким производством подшипников одним из самых первых в мире. FAG занимается этим с восемнадцатого века, когда Фридрих Фишер разработал и запатентовал специальный станок, который мог делать идеально круглые шарики.

Таким образом, Fisher AG (полное название бренда) вышел на мировой рынок из-за своей востребованности во многих промышленных сферах. Такой большой опыт способствует качеству продукции данного бренда сегодня, поэтому если вы планируете приобрести подшипники, FAG станет очень разумным выбором.

Как отличить от подделки

Итак, вот детали, на которые стоит обращать внимание до покупки подшипника или во время его обзора, чтобы не допустить подделки:

  • стоимость;
  • репутация магазина;
  • качество металла;
  • внутренняя обойма и качество ее обработки;
  • звук и состояние подшипника во время кручения;
  • наличие специальных гравировок и символов на самом подшипнике.

Начнем конечно же с цены. Очевидно, что такая продукция как подшипник у иностранного бренда со столетним опытом и отличающимся высоким качеством вряд ли будет стоить 200 гривен. Поэтому, если вы где-то наблюдали продукцию якобы от FAG, и она стоит такую скромную цену, не вздумайте ее приобретать – такой подшипник очень быстро выйдет из строя, так как это просто подделка.

Для покупки проверенной продукции ищите проверенный магазин. Это ограничит вас от покупки подделки, так как уважающий себя магазин не будет заниматься спекуляцией некачественной поддельной продукции за большую цену из-за риска потери репутации, которая очень дорога для торговых площадок.

Общее качество подшипника, который у вас на руках, очень несложно оценить. Обратите внимание на металл, из которого он сделан, покрутите его, посмотрите на обработку – это все поможет вам обезопасить себя от обмана.

Кроме этого, конкретно FAG-подшипники сами оставляют некоторые знаки для определения собственной продукции: на своих подшипниках производитель оставляет выгравированных три кода, по которым можно определить подлинность продукта на сайте производителя.

Твитнуть

Читайте также:

Устойчивость аэрозольных бактериальных вирусов к четырем бактерицидным продуктам

Abstract

Вирусные болезни могут распространяться различными путями, включая аэрозоли. Тем не менее, имеются ограниченные данные об эффективности аэрозольных химикатов для снижения вирусной нагрузки в воздухе. Бактериофаги (фаги) часто используются в качестве заменителей опасных вирусов в исследованиях аэрозолей, поскольку они недороги, просты в обращении и безопасны для лабораторных работников. Более того, некоторые из этих бактериальных вирусов обладают физическими характеристиками, сходными с патогенными вирусами человека и животных, такими как морфологический размер, тип нуклеиновых кислот, морфология капсида и наличие оболочки.В этом исследовании эффективность четырех химических веществ оценивалась на четырех переносимых по воздуху фагах при двух различных уровнях относительной влажности. Нехвостые бактериофаги MS2 (одноцепочечная РНК), ϕ6 (двухцепочечная РНК, оболочка), PR772 (двухцепочечная ДНК) и ϕX174 (одноцепочечная ДНК) сначала были распылены в ротационной камере объемом 55 л при 19 °. C при относительной влажности 25% и 50%. Затем перекись водорода, эвгенол (фенилпропен, используемый в коммерческих парфюмерии и ароматизаторах), Mist ® (автомобильное дезинфицирующее средство, содержащее триэтиленгликоль) и Pledge ® (дезинфицирующее средство для различных поверхностей, содержащее изопропанол, н-алкилдиметилбензил аммонийхлориды и н- Алкилдиметилэтилбензиламмоний хлорид) распыляли с фагами с использованием отдельного распылителя.Аэрозоли поддерживали во взвешенном состоянии в течение 10 минут, 1 часа и 2 часов. Образцы вирусных аэрозолей отбирали с помощью пробоотборника SKC BioSampler, а образцы анализировали с помощью количественной ПЦР и анализа бляшек. Уровни устойчивости четырех фагов варьировались в зависимости от относительной влажности (RH) и тестируемых бактерицидных продуктов. Фаг MS2 был наиболее стабильным вирусом, переносимым по воздуху в испытанных условиях окружающей среды, в то время как фаг PR772 был наименее стабильным. Pledge ® и эвгенол снизили инфекционность всех тестируемых фагов, переносимых по воздуху.При 25% относительной влажности Pledge ® и эвгенол были более эффективны в снижении инфекционности РНК-фагов ϕ6 и MS2. При относительной влажности 50% Pledge ® был наиболее эффективным агентом против фага MS2. Эти результаты показывают, что различные вирусы, передающиеся по воздуху, должны быть протестированы, чтобы продемонстрировать эффективность бактерицидных методов лечения. Это исследование также предоставляет набор параметров для тестирования бактерицидных продуктов в крупномасштабных условиях, чтобы снизить риск передачи вируса.

Образец цитирования: Turgeon N, Michel K, Ha T-L, Robine E, Moineau S, Duchaine C (2016) Устойчивость аэрозольных бактериальных вирусов к четырем бактерицидным продуктам. PLoS ONE 11 (12): e0168815. https://doi.org/10.1371/journal.pone.0168815

Редактор: Аделаида Алмейда, Университет Авейру, ПОРТУГАЛИЯ

Поступила: 2 сентября 2016 г .; Принята к печати: 6 декабря 2016 г .; Опубликован: 28 декабря 2016 г.

Авторские права: © Turgeon et al., 2016. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в документе.

Финансирование: Эта работа финансировалась Министерством устойчивого развития и энергетики Франции и проводилась в рамках французской исследовательской программы PRIMEQUAL. Конвенция № 12-MRES-Primequal-5-CVS-37. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Вирусные заболевания могут распространяться различными путями, такими как прямой контакт с инфицированным человеком или непрямой контакт с фомитами, воздействие крупных капель и вдыхание ядер аэрозольных капель. Последние представляют интерес, поскольку они могут находиться в воздухе в течение длительного периода времени и преодолевать большие расстояния. Передача вирусов воздушным путем была продемонстрирована для некоторых болезней, включая корь [1] и оспу [2]. Тем не менее, передача по воздуху других хорошо известных вирусов, таких как вирус гриппа и норовирус , все еще исследуется [3, 4].Внутренние помещения особенно благоприятны для передачи вируса, в том числе в больницах, где передача внутрибольничных заболеваний является серьезной проблемой [4–6]. Предполагается, что другие общественные или производственные помещения, такие как детские сады и очистные сооружения, представляют собой профессиональную опасность в отношении вирусных заболеваний [7, 8].

Если известно или предполагается, что в окружающей среде содержатся патогенные вирусы, переносимые по воздуху, необходимо принять меры для сведения к минимуму риска передачи вируса и снижения вирусной нагрузки.Факторы окружающей среды, такие как температура и относительная влажность (RH), имеют решающее влияние на инфекционность переносимых по воздуху вирусов и, естественно, могут способствовать снижению вирусных концентраций в воздухе [9]. Например, инфекционность передаваемых по воздуху вирусов гриппа минимальна между 40% и 50% относительной влажности по сравнению с 20% и 70% относительной влажности [10]. И наоборот, инфекционность коронавируса выше при относительной влажности 50% по сравнению с относительной влажностью 20% и 80% [11]. Инфекционность риновируса быстро снижается при относительной влажности 30% и 50% по сравнению с относительной влажностью 80% [12]. Следовательно, вирусный ответ на RH зависит от вируса.

При попытке снизить вирусную нагрузку, передаваемую по воздуху, следует также учитывать другие условия окружающей среды или меры вмешательства. Эксперименты с использованием озона [13, 14] и УФ-света [15–19] дали многообещающие результаты по инактивации переносимых по воздуху вирусов. Исследования, проведенные в контролируемых аэрозольных камерах, продемонстрировали значительное снижение инфекционности вируса при использовании озона или УФ-света для фагов T7 [13, 19], MS2 [13–15, 18, 19], ϕ6 [13, 15, 19], ϕX174 [13]. , 15, 19] и PR772 [15], а также для коронавируса [18], аденовируса [18], вируса репродуктивного и респираторного синдрома свиней (PRRS) [16] и вируса гриппа [17] .

Газообразное дезинфицирующее средство было протестировано на предмет инактивации вирусов, осажденных на различных поверхностях при температурах от 25 ° C до 55 ° C, согласно обзору Бирнса и Фуллера (2011). Другие исследовали эффективность многочисленных дезинфицирующих средств против вирусов при низких температурах (от -20 ° C до 4 ° C) [20]. Некоторые исследователи изучали потенциал химических растворов, таких как газообразный диоксид хлора, для уничтожения бактерий и грибков в виде аэрозолей в помещениях [21, 22]. Однако диоксид хлора обладает высокой реакционной способностью (его трудно транспортировать, он представляет опасность взрыва в виде газа, может диссоциировать на хлор и кислород во время хранения и т. Д.) и требует крайних мер безопасности, которые исключают его использование для обычной дезинфекции [23]. Насколько нам известно, информации об эффективности дезинфицирующих средств против переносимых по воздуху вирусов очень мало (или нет).

Бактериальные вирусы (бактериофаги или фаги) в настоящее время широко используются в качестве моделей в исследованиях аэрозолей [24]. Их относительно недорого производить в больших количествах, и они не требуют мер биологической безопасности. Фаги очень разнообразны, и некоторые из них обладают структурным сходством с вирусами человека и животных.Хвостатые фаги с двухцепочечной ДНК (дцДНК), такие как фаги Т4 и Т7, использовались в нескольких предыдущих исследованиях аэрозолей [24]. Однако, поскольку у эукариотических вирусов нет хвостов, в последние годы все чаще используются модели безхвостых фагов. РНК-фаг MS2 (семейство Leviviridae ) в настоящее время является одной из наиболее часто используемых моделей в исследованиях вирусных аэрозолей [24]. Фаг MS2 обладает высокой устойчивостью к аэрозолизации и взятию проб и представляет собой хороший суррогат вируса болезни Ньюкасла [25]. Также часто использовались фаги ϕX174 (семейство Microviridae ), ϕ6 (семейство Cystoviridae ) и PR772 (семейство Tectiviridae ) [13, 15, 25–29].Предыдущие исследования показали, что фаги ϕ6 и PR772 проявляют устойчивость к аэрозолизации и взятию проб воздуха, аналогичную вирусу гриппа [25]. Считается, что фаг ϕ6 является хорошей моделью для вируса гриппа , поскольку он представляет собой оболочечный вирус с сегментированным геномом РНК. Паттерн устойчивости к относительной влажности, проявляемый фагом ϕ6 (устойчивый при низкой относительной влажности, очень чувствительный при средней относительной влажности, чувствительный при высокой относительной влажности), аналогичен тому, что был описан для вируса гриппа [10, 15].

В исследовании Verreault et al. (2015), вращающуюся камеру окружающей среды использовали для воздействия на вышеуказанные четыре модели фага (MS2, ϕX174, ϕ6 и PR772) 20%, 50% и 80% относительной влажности при 18 ° C и 37 ° C в течение различного времени до до 14 часов. Каждый фаг по-разному реагировал на условия окружающей среды. Это предполагает, что этот набор фагов может быть эффективно использован в качестве имитаторов вируса в исследованиях биоаэрозолей. Здесь мы исследовали эффективность четырех химических или коммерческих продуктов (перекись водорода, эвгенол, MiST ® и Pledge ® ) для инактивации четырех моделей переносимых по воздуху фагов с использованием одной и той же камеры окружающей среды при 19 ° C, ниже 25% и 50%. % Относительной влажности.

Материалы и методы

Бактерии и фаги

фагов и бактериальных штаммов-хозяев, использованных в этом исследовании, были получены из Справочного центра бактериальных вирусов Феликса д’Эрелля (www. phage.ulaval.ca) и перечислены в таблице 1. Триптический соевый бульон (TSB) и триптический соевый агар ( TSA) культуральные среды были приобретены в лаборатории Difco (Детройт, штат Мичиган). Фаги MS2 и ϕX174 размножали на своем бактериальном хозяине, выращенном в TSB, как описано ранее [26, 27]. Фаг ϕ6 выращивали на своем хозяине на мягком агаре TSA (0.75%), как описано в другом месте [27], тогда как фаг PR772 амплифицировали на чашках с мягкой агарозой TSB (0,75%) [30]. Лизаты фагов титровали на их соответствующих бактериальных хозяевах с использованием анализа бляшек с TSA и мягким агаром TSB [31].

Эксперименты по аэрозолизации

Экологическая камера, использованная в этом исследовании, состояла из цилиндрической алюминиевой бочки объемом 55 л, установленной на шарикоподшипниках с двойным уплотнением на обоих концах. Внутренние части подшипников остаются неподвижными при вращении барабана.Зонды и отверстия для отбора проб устанавливались на невращающейся части барабана. Барабан был установлен в изолированном корпусе, в котором можно было регулировать температуру с помощью термоэлектрических сборок. Экологическая камера более подробно описана Verreault et al. (2014, 2015). Жидкость для распыления состояла из 1 мл каждого лизата фага (10 9 -10 10 БОЕ / мл) и 100 мкл пеногасителя A (Sigma-Aldrich, Оквилл, Онтарио, Канада), чтобы избежать пены в распылителе.Пеногаситель A не влияет на инфекционность фагов, как было продемонстрировано ранее [15]. Жидкость для распыления доводили до 50 мл фаговым буфером (20 мМ Трис-HCl, 100 мМ NaCl, 10 мМ MgSO4, pH 7,5). Фаги распыляли с использованием 6-струйного распылителя Коллисона (BGI, Waltham, MA), приводимого в действие сжатым воздухом под давлением 20 фунтов на квадратный дюйм в течение 10 минут.

Четыре протестированных бактерицидных раствора: 3% перекись водорода (Sigma-Aldrich), 10% Eugenol (фенилпропен, используемый в коммерческих духах и ароматизаторах, Sigma-Aldrich), MiST ® (автомобильное дезинфицирующее средство, содержащее 10% триэтиленгликоля) и Pledge ® (дезинфицирующее средство для многих поверхностей, содержащее 1% изопропанола, 0. 0001% хлоридов н-алкилдиметилбензиламмония и 0,0001% хлорида н-алкилдиметилэтилбензиламмония). Бактерицидные растворы распыляли с использованием Aeroneb Lab (Aerogen Inc, Голуэй, Ирландия), заполненной 5 мл тестируемого раствора. После распыления измеряли оставшийся объем испытуемого химического вещества, чтобы рассчитать объем аэрозоля. Концентрации бактерицидных агентов, полученные в аэрозольной камере (C T , мг / л), приведены в таблице 2.

Эти концентрации были рассчитаны в соответствии с уравнением 1 [32], предполагая идеальное перемешивание и однородную концентрацию в камере, со следующими параметрами: объем камеры (V = 55 л), концентрация бактерицидного раствора (S, мг / мл), объем аэрозольного раствора. (A, мл), входящий поток воздуха (D = 12 л / мин), выходной поток воздуха, равный входящему потоку воздуха, время распыления (T = 10 мин), начальная концентрация в камере 0 мг / л.

(1)

диффузионных сушилок использовались для удаления избыточной влаги из аэрозоля до того, как он достигнет камеры. Шестьдесят девять дюймов диффузионной сушилки использовались для достижения относительной влажности 50%, а 108 дюймов использовались для достижения относительной влажности 25%. Вращение камеры было установлено на 1 об / мин, чтобы аэрозоли находились во взвешенном состоянии. Аэрозоли оставались взвешенными во вращающейся камере в течение 10 минут, 1 часа и 2 часов. Для каждого эксперимента температуру устанавливали на 19 ° C, чтобы поддерживать диапазон температур от 18 ° C до 22 ° C. Относительную влажность и температуру регистрировали с помощью зонда (модель RH-USB, Omega), установленного во вращающейся камере.Распределение частиц по размерам и концентрацию измеряли с помощью прибора для определения размера частиц (APS) (модель 3321, TSI Inc., Shoreview, MN), оборудованного разбавителем 1/100 (модель 3302A, TSI Inc.) сразу после аэрозолизации, после 10-минутной стабилизации. , и перед отбором проб.

Образцы аэрозолей

отбирали с помощью SKC BioSampler (SKC Inc., Eighty Pour, PA), заполненного 20 мл фагового буфера, в течение 20 минут при 12,5 л / мин (определяется по критическому отверстию прибора). Воздух подавался в SKC BioSampler с помощью насоса SKC (модель 228–9605).Образцы воздуха и растворы небулайзера анализировали с помощью количественной ПЦР и анализа бляшек. Образцы хранили при 4 ° C не более 3 часов, пока они не были проанализированы с помощью анализа налета. Аликвоты хранили при –20 ° C для выделения РНК и количественной ПЦР (3–6 дней). Во время каждого эксперимента по аэрозолизации камеру заполняли и давали возможность стабилизироваться в течение 10 минут. Затем немедленно отбирали пробы аэрозолей (момент времени воздействия 0 ч) или выдерживали в камере в течение 1 или 2 часов. Во время отбора проб воздуха концентрация аэрозоля в камере экспоненциально спадала.Пятьдесят процентов аэрозолей было собрано в течение первых трех минут отбора проб воздуха с помощью SKC BioSampler, как рассчитано по формуле 2 [32]. Начальная концентрация принималась равной 100% (C i ), воздух на входе и выходе составлял 12,5 л / мин, а на входе аэрозоль был чистый воздух, профильтрованный HEPA. В течение двадцати минут отбора проб воздуха с помощью SKC BioSampler из камеры было собрано 99% аэрозолей. Следовательно, камера должна быть заполнена для каждого тестируемого момента времени, и, таким образом, каждый набор условий тестирования считался отдельным экспериментом.Все испытанные условия и временные точки были повторены дважды. Фаги также распыляли без бактерицидных агентов в качестве контрольных экспериментов. Содержимое небулайзера анализировали с использованием бляшек до и после аэрозолизации, чтобы измерить инфекционность фага на протяжении экспериментов.

(2)

Холостые опыты и очистка камеры

Перед каждым экспериментом по аэрозолизации камеру продували чистым медицинским воздухом со скоростью 20 л / мин в течение 30 минут. После продувки с помощью APS не было обнаружено никаких частиц.Все трубки отсоединяли от камеры и очищали ежедневно, чтобы избежать переноса фагов между экспериментами. Контрольные эксперименты были проведены путем аэрозолизации фагового буфера без какого-либо фага, чтобы убедиться, что процедура очистки и процесс очистки были эффективными. Образцы из этих холостых аэрозолизов обрабатывали с использованием тех же процедур, что и для других образцов.

Экстракция РНК и КПЦР

Геномная РНК фагов ϕ6 и MS2 была извлечена и подвергнута обратной транскрипции в кДНК, как описано ранее [27].Вкратце, РНК фага экстрагировали с использованием мининабора вирусной РНК QIAamp. Носитель РНК был исключен из буфера Qiagen AVL, и РНК была элюирована 2 объемами 40 мкл буфера ТЕ (10 мМ Трис, 0,1 мМ EDTA). РНК хранили при –80 ° C или сразу обрабатывали для синтеза кДНК. РНК нагревали (100 ° C, 5 минут) перед проведением синтеза кДНК с использованием набора iScript cDNA Synthesis (Bio-Rad Laboratories), следуя инструкциям производителя, используя 10 мкл образцов. Праймеры и зонды, используемые для реакций кПЦР, перечислены в таблице 3 и были предоставлены Integrated DNA Technologies (IDT).Зонды были помечены красителем FAM в 5 ‘и комбинацией гасителей Zen и Iowa black FQ в 3’. Количественные ПЦР-анализы для фагов ϕ6 и MS2 [27] и фагов PR772 [25] и ϕX174 [26] были разработаны в предыдущих исследованиях. Полные протоколы обнаружения этих четырех фагов количественной ПЦР можно найти в следующей ссылке [15]. Вкратце, каждая 20 мкл реакционной смеси содержала следующее: 10 мкл супермиксы 2X iQ для зонда (Bio-Rad Laboratories), 2 мкл кДНК (MS2 и ϕ6) или 5 мкл образца (PR772 и ϕX174) и 1 мкМ прямого и обратные праймеры.Реакционная смесь также содержала следующие концентрации зонда: 150 нМ, 300 нМ, 200 нМ и 200 нМ для MS2, ϕ6, ϕX174 и PR772 соответственно. Реакции проводили с использованием BioRad CFX 96 или BioRad CFX384. Программа ПЦР была следующей: 95 ° C в течение 5 минут, затем 39 циклов 95 ° C в течение 10 секунд, 60 ° C в течение 30 секунд и измерения флуоресценции.

Расчет данных

Для измерения инфекционных фагов во всех образцах использовали анализ

бляшек. В предыдущих экспериментах было продемонстрировано, что геномы вирусов стабильны в условиях отбора проб воздуха, использованных в этом исследовании [15, 25, 33], поэтому количественная ПЦР использовалась для измерения общего количества геномов фагов во всех образцах. Соотношение инфекционных фагов в образцах воздуха рассчитывали путем деления количества инфекционных фагов, определенного с помощью анализов бляшек, на количество фаговых геномов, оцененных с помощью кПЦР. Поскольку инфекционное соотношение зависит от экстракции РНК, синтеза кДНК и эффективности КПЦР [27], а также агрегатов в анализах бляшек, значение может быть ниже или выше 1. Смещение этих анализов является фаг-специфичным, и поэтому инфекционные коэффициенты не должны быть используется для сравнения фагов. Однако инфекционные соотношения можно использовать для сравнения влияния условий окружающей среды (относительная влажность и время воздействия) на каждый фаг, поскольку ограничения, вероятно, одинаковы для всех образцов одного и того же фага.

Эффект бактерицидных агентов был выражен как относительное отношение количества инфекционных фагов, аэрозольных с химическими веществами, деленное на отношение инфекционных фагов, аэрозольных без химикатов, как показано в уравнении 3.

(3)

Статистический анализ

Данные были выражены с использованием среднего ± стандартное отклонение или медианы (межквартильный размах) для обобщения характеристик анализа. Данные были проанализированы с использованием двустороннего дисперсионного анализа с эффектом взаимодействия. ANOVA были приспособлены для сравнения разнородных дисперсий между уровнями влажности или «коммерческих продуктов» с тремя периодами времени и были проверены, можно ли преобразовать модели в ANOVA с той же дисперсией по уровням факторов.Предположение одномерной нормальности было проверено с использованием тестов Шапиро-Уилка на распределение ошибок из статистической модели после факторизации Холецкого. Вариация Брауна и Форсайта критерия Левена использовалась для проверки однородности дисперсий. При необходимости некоторые переменные были преобразованы в логарифмическую форму для выполнения предположений модели. Сообщенные p-значения были основаны на этих преобразованиях. Когда эти предположения не были выполнены, использовалась альтернативная процедура, называемая преобразованием рангов. При преобразовании ранга наблюдения заменяются их рангом, и применяется обычный F-тест из ANOVA. Этот анализ не зависит от предположений, требуемых вариацией Брауна и Форсайта для теста Левена. Этот метод дал хорошие статистические характеристики по сравнению со стандартным тестом. Когда результаты необработанных или преобразованных логарифмических данных сравнивались с рангами и давали аналогичные результаты, данные стандартных анализов сохранялись. Когда результаты различались, предпочтение отдавалось данным преобразования рангов.Апостериорные сравнения проводили с использованием сравнительного теста Тьюки. Результаты считались значимыми, когда p-значения ≤ 0,05. Данные анализировали с помощью статистического пакета программы SAS v9.4 (SAS Institute Inc.).

Результаты

Характеристики аэрозоля

Концентрация частиц в аэрозольной камере составляла от 4,8 x 10 4 до 1,2 x 10 5 частиц на кубический сантиметр. Средний массовый аэродинамический диаметр (MMAD) составлял от 0,9 до 1. 1 мкм сразу после аэрозолизации. Концентрация частиц и MMAD внутри камеры соответствовали предыдущим данным [34]. Зарегистрированные температура и относительная влажность незначительно варьировались внутри экспериментов и между экспериментами. Во всех экспериментах температура колебалась от 18 ° C до 21,3 ° C. Уровни относительной влажности варьировались от 24,6% до 26,5% для экспериментов, установленных при 25% относительной влажности, в то время как относительная влажность варьировалась от 48,2% до 52,4% при установке на 50%.

Влияние относительной влажности на инфекционность переносимых по воздуху фагов

Контрольные эксперименты были проведены для оценки влияния 10 минут, 1 часа и 2 часов воздействия 25% и 50% RH на инфекционность аэрозольных фагов (рис. 1).Для фага MS2 не наблюдалось значительного влияния относительной влажности или времени воздействия, что подтверждает его стабильность в воздухе. Однако наблюдалось значительное влияние времени воздействия на фаг ϕX174 как при 25%, так и при 50% относительной влажности (p <0,0001), что позволяет предположить, что этот фаг не может сохраняться в течение длительного периода времени в состоянии переносимости по воздуху. Наконец, мы наблюдали значительную разницу между воздействием 25% и 50% относительной влажности для фагов ϕ6 и PR772 (p <0,0001). Фаг ϕ6 был очень стабилен при воздействии 25% относительной влажности. Однако он был очень нестабильным при относительной влажности 50%, что свидетельствует о предпочтении менее влажной среды.Напротив, фаг PR772 был крайне нестабилен при 25% относительной влажности, поскольку результаты анализа бляшек были ниже предела обнаружения для всех времен воздействия. PR772 также был крайне нестабилен при относительной влажности 50% после 1 часа и 2 часов воздействия, что позволяет предположить, что этот фаг плохо адаптирован к этим условиям окружающей среды. Из-за этой нестабильности эксперименты с использованием Phage PR772 были прекращены.

Рис. 1. Влияние относительной влажности и времени экспозиции на четыре аэрозольных модели фага.

Эксперименты проводились при 19 ° C и относительной влажности 25% (черные кружки) и 50% (черные квадраты).a, b, c указывают на значительный эффект времени экспозиции для фагов ϕX174 и PR772. Звездочка (*) указывает на значительную разницу между 25% и 50% относительной влажности для фагов ϕ6 и PR772.

https://doi.org/10.1371/journal.pone.0168815.g001

Влияние бактерицидных агентов на относительную инфекционность

После попадания в воздух влияние бактерицидных продуктов, относительной влажности и времени воздействия на инфекционность фага, вероятно, является кумулятивным. Уровни инфекционных фаговых частиц определяли после воздействия четырех бактерицидных продуктов на четыре бактерицидных продукта при 25% и 50% RH и сравнивали с контрольными значениями, полученными без бактерицидного продукта при том же уровне RH и времени воздействия.Как указано в разделе «Материалы и методы», данные представлены в виде относительных коэффициентов инфекционности, что позволяет анализировать только действие бактерицидного продукта без вмешательства RH. Контрольные значения, полученные без бактерицидного продукта (коэффициент относительной инфекционности = 1), представлены пунктирными линиями на рис. 2–4.

Рис. 2. Влияние Pledge ® (черные квадраты), эвгенола (серые круги), MiST ® (белые треугольники) и h3O2 (серые перевернутые треугольники) на инфекционность переносимого по воздуху фага MS2.

Эксперименты проводились при 19 ° C и относительной влажности 25% и 50%. Пунктирная линия указывает контрольное значение без химического агента для той же относительной влажности и времени воздействия. a и b указывают на значительное влияние времени воздействия всех химических агентов на относительные коэффициенты инфекционности MS2. Звездочка (*) и ⌘ указывают на существенные различия между эффектами Pledge ® и MiST ® , Pledge ® и H 2 O 2 , Eugenol и MiST ® , Eugenol и H 2 O 2 на коэффициенты инфекционности MS2 при относительной влажности 25% и значительные различия между эффектами Pledge ® и Eugenol и Pledge ® и H 2 O 2 на коэффициенты инфекционности MS2 при относительной влажности 50% .

https://doi.org/10.1371/journal.pone.0168815.g002

Рис. 3. Эффект Pledge ® (черные квадраты), эвгенол (серые круги), MiST ® (белые треугольники) и h3O2 (серые перевернутые треугольники) на инфекционность переносимого по воздуху фага ϕX174.

Эксперименты проводились при 19 ° C и относительной влажности 25% и 50%. Пунктирная линия указывает контрольное значение без химического агента для той же относительной влажности и времени воздействия. Не наблюдалось значительного влияния времени воздействия или химического агента.

https://doi.org/10.1371/journal.pone.0168815.g003

Рис. 4. Эффект Pledge ® (черные квадраты), эвгенол (серые круги), MiST ® (белые треугольники) и h3O2 (серые перевернутые треугольники) на инфекционность переносимого по воздуху фага ϕ6.

Эксперименты проводились при 19 ° C и относительной влажности 25% и 50%. Результаты, полученные при относительной влажности 50%, были ниже предела обнаружения. Пунктирная линия указывает контрольное значение без химического агента для той же относительной влажности и времени воздействия.a и b указывают на значительное влияние времени воздействия Pledge ® на инфекционность фага ϕ6. Звездочка (*) и ⌘ указывают на существенные различия между эффектом Pledge ® и MiST ® и между Pledge ® и H 2 O 2 .

https://doi.org/10.1371/journal.pone.0168815.g004

Все бактерицидные продукты оказали значительное влияние на относительную инфекционность фага MS2 при относительной влажности 25% (p <0,003) и 50% RH (p <0.005) (рис.2). Продолжительность химического воздействия также оказала значительное влияние на фаг MS2, особенно при относительной влажности 50% (p <0,003). Хотя уменьшение количества инфекционных частиц MS2 было замечено между 1 и 2 часами воздействия всех бактерицидных продуктов при 25% относительной влажности, влияние времени воздействия не было значительным в этих условиях (p = 0,06). При 25% относительной влажности время воздействия 1 час и 2 часа с использованием Pledge ® и Eugenol было в 5-10 раз более эффективным, чем MiST ® и H 2 O 2 в отношении снижения относительных инфекционных соотношений фага MS2 ( р <0.03). При относительной влажности 50% Pledge ® снижал относительные инфекционные отношения фага MS2 в 5-10 раз больше, чем MiST ® и эвгенол (p <0,05). В целом, максимальное снижение менее чем на два порядка было отмечено во всех условиях, испытанных с фагом MS2.

Инфекционные частицы фага ϕX174 были уменьшены на один порядок при воздействии Pledge ® и эвгенола при 25% относительной влажности (рис. 3). При относительной влажности 50% 10 минут воздействия Pledge ® или Eugenol снижали количество инфекционных частиц фага ϕX174 в 50 и 500 раз по сравнению с контрольными значениями без бактерицидного продукта.Однако через 1 час и 2 часа воздействия при относительной влажности 50% снижение фага ϕX174 было менее выраженным (рис. 3).

Инфекционные частицы фага ϕ6 были уменьшены от 10 до 1000 раз при 25% относительной влажности при воздействии Pledge ® (рис. 4) (p <0,006). Pledge ® был значительно более эффективным, чем MiST ® и H 2 O 2 в снижении относительных инфекционных соотношений фага ϕ6 (p <0,001). Все результаты анализа бляшек были ниже предела обнаружения с фагом ϕ6 при 50% относительной влажности.

Обсуждение

Влияние относительной влажности

Аэрозолизация и отбор проб воздуха создают значительную нагрузку на микроорганизмы. Условия окружающей среды и время нахождения в воздухе также являются критическими факторами, влияющими на выживание микробов и длительную инфекционность вирусов. Известно, что такие вирусы, как грипп , норовирус мыши , аденовирус , коронавирус , а также несколько фагов теряют инфекционность с течением времени после попадания в воздух [4, 15, 18, 25]. Следовательно, эти факторы необходимо также учитывать при измерении эффективности бактерицидных агентов в отношении переносимых по воздуху микроорганизмов и вирусов.

В предыдущем исследовании [15] мы продемонстрировали, что температура (18 ° C, 37 ° C), относительная влажность (20%, 50%, 80%) и время нахождения в воздухе (0 час, 1 час, 6 часов, 14 часов) влияют на инфекционность. переносимых по воздуху фагов MS2, PR772, ϕX174 и ϕ6 по-разному. Эти более ранние эксперименты проводились с использованием той же аэрозольной камеры, распылителя и пробоотборника воздуха, которые использовались в текущем исследовании. Однако были изменены некоторые параметры.Добавление второго небулайзера для аэрозолизации бактерицидных агентов привело к модификации установки по сравнению с предыдущим исследованием. Аэрозольные фаги пропускали через диффузионные сушилки для удаления влаги перед смешиванием с аэрозольными агентами во втором наборе диффузионных сушилок. Самая низкая относительная влажность, которая могла быть достигнута в экспериментах с использованием H 2 O 2 и MiST ® , и при котором 5 мл бактерицидного продукта были распылены в виде аэрозоля, составляла 25%. Поэтому контрольные эксперименты без агентов проводились при относительной влажности 25%.Эти контроли без агентов очень важны, потому что они устанавливают эталонное значение, используемое для оценки бактерицидного эффекта агентов, как объяснено в уравнении 3.

Хотя тестируемые условия окружающей среды были разными, наши результаты согласуются с предыдущими исследованиями, что указывает на воспроизводимость данных. Например, ранее было замечено, что фаг MS2 очень стабилен в аэрозольном состоянии [15, 18, 25, 27]. Наши результаты также подтверждают, что аэрозольный фаг PR772 более заразен при средних и высоких уровнях RH (50% и 80%) по сравнению с низкими уровнями RH (20% или 25%, [15], тогда как фаг ϕ6 был более устойчивым при низких уровнях RH (20%). % или 25%) по сравнению со средней (50%) и высокой относительной влажностью [15].Ранее было обнаружено, что фаг ϕX174 более устойчив к 80% относительной влажности по сравнению с 20% и 50% [15]. Хотя здесь не проверялось воздействие 80% относительной влажности, мы не наблюдали значительных различий между инфекционностью при 25% и 50% относительной влажности.

Приведенные выше данные ясно показывают, что устойчивость к условиям окружающей среды зависит от вируса. Тем не менее, было показано, что аденовирус и риновирус заразны в течение более длительных периодов времени при воздействии высоких уровней RH, подобно фагам PR772 и ϕX174 [12, 35].Однако хорошо задокументировано, что вирусы гриппа более стабильны при низких уровнях RH, как это наблюдается для фага ϕ6 [36, 37]. Фаг MS2 был наиболее стабильным вирусом, переносимым по воздуху в испытанных здесь условиях (рис. 1). В целом, приведенные выше данные подтверждают необходимость тестирования различных фагов с разными свойствами в исследованиях аэрозолей.

Действие бактерицидных продуктов

Pledge ® (содержащий изопропанол, н-алкилдиметилбензиламмонийхлориды и н-алкилдиметилэтилбензиламмонийхлорид) и эвгенол снижали относительные коэффициенты инфицирования всех тестируемых фагов, переносимых по воздуху.Однако эффект был статистически значимым только для двух РНК-фагов, MS2 и ϕ6 (рис. 2 и 3). Неожиданно относительные инфекционные отношения фага ϕ6 были выше единицы при аэрозольной обработке MiST ® (содержащего триэтиленгликоль), что может указывать на защитный эффект на инфекционность фага (рис. 3). Эксперименты с использованием фага ϕX174 показали, что относительные инфекционные отношения были ниже единицы с Pledge ® , Eugenol и H 2 O 2 при относительной влажности 25% и с Pledge ® и Eugenol при относительной влажности 50% (рис. ).Эти данные показывают, что химические вещества снижали инфекционность переносимого по воздуху фага ϕX174 по сравнению с контрольными значениями без бактерицидного продукта. Время нахождения в воздухе также оказывает сильное влияние на инфекционность фага ϕX174 (рис. 1). В течение 1 часа и 2 часов воздействия при относительной влажности 50% влияние бактерицидных агентов на снижение относительных инфекционных соотношений фага ϕX174 было менее выраженным из-за эффекта увеличения времени воздействия (рис. 4). Действие бактерицидных агентов на четыре фага суммировано в таблице 4.Другие также наблюдали вирусозависимую реакцию на санитарные условия. Коронавирус оказался в 7–10 раз более уязвим к УФ-излучению, чем аденовирус и фаг MS2 [18]. Фаги T7 и MS2 были более устойчивы к озону, чем ϕ6 и ϕX174 [13], а T7 более устойчивы к УФ-излучению, чем MS2, ϕ6 и ϕX174 [19].

Продолжительность распыления с использованием Aeroneb Lab зависит от содержимого аэрозольного раствора. Например, растворы на основе этанола и изопропанола (> 30%) медленно превращаются в аэрозоль по сравнению с растворами на водной основе (более чем в 7 раз дольше, чтобы распылить тот же объем).Лаборатория Aeroneb широко используется в исследованиях доставки лекарств, поскольку она является неразрушающей, может использоваться от 5 до 30 литров воздуха в минуту, не влияя на объем распыляемой жидкости, и может распылять> 0,2 мл раствора на водной основе в минуту [ 38]. Поскольку состав каждого из используемых бактерицидных агентов был разным, аэрозольный объем и концентрация, достигаемая в камере для каждого агента, также были разными (таблица 2). В нашей экспериментальной установке необходимо было подогнать время бактерицидного распыления к времени распыления фага.Время распыления было установлено равным 10 мин, чтобы достичь одинаковой концентрации фага в камере для всех анализов. Поскольку на инфекционность фагов PR772 и ϕX174 сильно влияет их время нахождения в воздухе, было важно стандартизировать время распыления, бактерицидное воздействие и время отбора проб. Следовательно, было невозможно увеличить время аэрозолизации для увеличения концентрации бактерицидного агента в камере. Несмотря на более низкие концентрации гермицидов в камере по сравнению с MiST ® и H 2 O 2 , Pledge ® и Eugenol привели к наибольшему снижению (до 3 log) переносимых по воздуху вирусов.

Предыдущие исследования показали, что 10–20 секунд воздействия ультрафиолетового света или озона уменьшают количество оставшихся инфекционных вирусов в аэрозольной камере на 90% [13, 15]. Поскольку испытанные дозы вредны для человека, эти методы можно использовать в вентиляционных каналах или потолках, но не в жилых помещениях. В текущем исследовании два часа воздействия Pledge ® или эвгенола были необходимы для 1-логарифмического снижения инфекционного фага MS2. Для фагов ϕ6 и ϕX174 это 1-логарифмическое снижение было достигнуто только через 10 минут (время 0) воздействия Pledge ® и эвгенолом.

Средний предел воздействия H 2 O 2 в течение восьмичасовой рабочей смены (TWA), рекомендованный ACGIH, составляет 1 ppm (http://www.cdc.gov/niosh/idlh/772841.html) . Концентрация H 2 O 2 , использованная в этом исследовании (1209 ppm), превышает рекомендации ACGIH TWA более чем на 1200 ppm и дала плохие результаты по снижению инфекционности фага. Триэтиленгликоль (содержащийся в MiST ® ) является одним из продуктов, используемых в дымовых машинах для производства пара, похожего на туман или дым.Пределы воздействия для триэтиленгликоля не установлены. Тем не менее, предельное значение порога (ПДК), рекомендованное ACGIH для этиленгликоля (другого компонента, используемого в туманных машинах), составляет 100 мг / м 3 (https://www.osha.gov/dts/chemicalsampling/data/CH_240404. html). Концентрация, использованная в этом исследовании (900 мг / м 3 ) превышает эту рекомендацию в девять раз и не привела к значительному снижению инфекционности вируса. Следовательно, H 2 O 2 и MiST ® не рекомендуются для снижения концентрации вирусов, переносимых по воздуху, в жилых помещениях.

Концентрация изопропанола (из Pledge ® ), использованная в этом исследовании (16 ppm), в 25 раз ниже рекомендованных рекомендаций ACGIH TWA (400 ppm, http://www.cdc.gov/niosh/idlh/67630.html ). Концентрация двух других активных ингредиентов в Pledge ® (н-алкилдиметилбензиламмонийхлориды и н-алкилдиметилэтилбензиламмонийхлорид) для обоих составляла 2 ч. / Млн. Рекомендации TWA для этих солей четвертичного аммония отсутствуют. Концентрация эвгенола, использованная в данном исследовании, составляла 16 частей на миллион, однако рекомендации TWA для этого продукта не установлены.Поскольку очень низкие концентрации активных ингредиентов могут значительно снизить инфекционность фага, Pledge ® и Eugenol могут быть протестированы в людных помещениях и могут способствовать снижению риска передачи вируса.

Заключение

Четыре фага, использованные в этом исследовании, показали разные уровни устойчивости к RH и бактерицидным продуктам после попадания в воздух. Эти результаты подтверждают идею о том, что требуется более одного вирусного агента, чтобы действительно продемонстрировать эффективность бактерицидного лечения.Pledge ® и Eugenol были наиболее эффективными продуктами для снижения вирусной нагрузки в аэрозолях, хотя активные ингредиенты в Pledge ® , ответственные за эти действия, не были выяснены. В настоящее время разрабатываются крупномасштабные исследования свободных и занятых помещений, чтобы выяснить, можно ли использовать эти продукты для снижения вирусной нагрузки, передаваемой по воздуху, в помещениях.

Благодарности

Мы благодарны Сержу Симару за статистический анализ, а также Джеральду Кенаниану за его помощь в экспериментах.Авторы выражают признательность Аманде Кейт Топерофф за английскую редакцию рукописи. CD. является старшим научным сотрудником FRQ-S и членом сети FRQ-S Respiratory Health Network. С.М. заведует кафедрой исследований бактериофагов уровня 1 в Канаде.

Вклад авторов

  1. Концептуализация: CD SM ER T-LH.
  2. Формальный анализ: KM NT.
  3. Финансирование: T-LH ER CD.
  4. Расследование: KM NT.
  5. Методология: CD SM NT.
  6. Администрация проекта: CD.
  7. Ресурсы: CD NT.
  8. Контроль: CD.
  9. Подтверждение: CD SM NT KM.
  10. Визуализация: NT KM.
  11. Написание – первоначальный эскиз: NT KM.
  12. Написание – просмотр и редактирование: CD KM SM T-LH ER.

Ссылки

  1. 1.Лоренц Д., Альбрехт П. Восприимчивость тамаринов (Saguinus) к вирусу кори. Lab Anim Sci. 1980; 30: 661–5. pmid: 6775133
  2. 2. Milton DK. Каков основной путь передачи оспы? Значение для биозащиты. Front Cell Infect Microbiol. 2012; 2: 150. pmid: 23226686
  3. 3. La Rosa G, Fratini M, Della Libera S, Iaconelli M, Muscillo M. Вирусные инфекции, передаваемые в помещении воздушно-капельным или контактным путем. Энн Ист Супер Санита.2013; 49: 124–32. pmid: 23771256
  4. 4. Bonifait L, Charlebois R, Vimont A, Turgeon N, Veillette M, Longtin Y и др. Выявление и количественное определение норовируса, передающегося по воздуху, во время вспышек в медицинских учреждениях. Clin Infect Dis. 2015; 61: 299–304. pmid: 255
  5. 5. Блачер Ф., Линдсли В., Пирс Т., Андерсон С., Фишер М., Хаку Р. и др. Измерение вируса гриппа, передающегося по воздуху, в отделении неотложной помощи больницы. Clin Infect Dis. 2009. 48: 438–40. pmid: 198
  6. 6.Бишофф В.Е., Светт К., Ленг И., Петерс Т.Р. Воздействие аэрозолей вируса гриппа во время обычного ухода за пациентами. J Infect Dis. 2013; 207: 1037–46. pmid: 23372182
  7. 7. Бибби К., Печчиа Дж. Идентификация разнообразия вирусных патогенов в иле сточных вод с помощью анализа метагенома. Environ Sci Technol. 2013; 47: 1945–51. pmid: 23346855
  8. 8. Бибби К., Печча Дж. Распространенность респираторных аденовирусов видов B и C в иле сточных вод. Воздействие процесса Environ Sci. 2013; 15: 336–8.pmid: 25208697
  9. 9. Тан JW. Влияние параметров окружающей среды на выживаемость переносимых по воздуху инфекционных агентов. Интерфейс J R Soc. 2009; 6: S737–46. pmid: 19773291
  10. 10. Schaffer FL, Soergel ME, Straube DC. Выживаемость вируса гриппа, передающегося по воздуху: влияние распространяющегося хозяина, относительная влажность и состав жидкостей для опрыскивания. Arch Virol. 1976; 51: 263–73. pmid: 987765
  11. 11. Иджаз М.К., Бруннер А.Х., Саттар С.А., Наир Р.С., Джонсон-Люссенбург CM.Характеристики выживаемости при переносимом воздушно-капельным путем коронавируса человека 229E. J Gen Virol. 1985; 66 (Pt 12): 2743–8.
  12. 12. Карим Ю.Г., Иджаз М.К., Саттар С.А., Джонсон-Люссенбург CM. Влияние относительной влажности на выживаемость риновируса-14 в воздухе. Может J Microbiol. 1985; 31: 1058–61. pmid: 3004682
  13. 13. Цзэн Ч.С., Ли Ч.С. Озон для инактивации аэрозольных бактериофагов. Аэрозоль Sci Tech. 2006; 40: 683–9.
  14. 14. Гриншпун С.А., Адхикари А., Хонда Т., Ким К.Ю., Тойвола М., Рао К.С.Р. и др.Контроль аэрозольных загрязнений в воздухе помещений: сочетание снижения концентрации частиц с микробной инактивацией. Environ Sci Technol. 2007; 41: 606–12. pmid: 17310729
  15. 15. Верро Д., Марку-Вуазель М., Тюржон Н., Муано С., Дюшен С. Устойчивость аэрозольных бактериальных вирусов к относительной влажности и температуре. Appl Environ Microbiol. 2015; 81: 7305–11. pmid: 26253683
  16. 16. Катлер Т.Д., Ван Ц., Хофф С.Дж., Циммерман Дж.Дж. Влияние температуры и относительной влажности на ультрафиолетовую (UN254) инактивацию переносимого по воздуху вируса респираторного и репродуктивного синдрома свиней.Vet Microbiol. 2012; 159: 47–52. pmid: 22542268
  17. 17. McDevitt JJ, Rudnick SN, Radonovich LJ. Чувствительность вируса гриппа к воздействию ультрафиолетового излучения C в виде аэрозолей. Appl Environ Microbiol. 2012; 78: 1666–9. pmid: 22226954
  18. 18. Уокер С.М., Ко Г. Эффект ультрафиолетового бактерицидного облучения на вирусные аэрозоли. Environ Sci Technol. 2007. 41: 5460–5. pmid: 17822117
  19. 19. Цзэн Ч.С., Ли Ч.С. Инактивация вирусосодержащих аэрозолей бактерицидным ультрафиолетовым облучением.Аэрозоль Sci Tech. 2005; 39: 1136–42.
  20. 20. Dee S, Deen J, Burns D, Douthit G, Pijoan C. Оценка дезинфицирующих средств для санитарной обработки транспортных средств, зараженных вирусом репродуктивного и респираторного синдрома свиней, при низких температурах. Может J of Vet Res. 2005; 69: 64–70.
  21. 21. Hsu C-S, Huang D-J. Эффективность дезинфекции газообразным диоксидом хлора в студенческих столовых на Тайване. J Air Waste Manage Assoc. 2013; 63: 796–805.
  22. 22. Hsu C-S, Huang D-J.Оценка и улучшение качества воздуха в школьном общественном лифте. Оценка состояния окружающей среды. 2014; 186: 2941–8. pmid: 24374804
  23. 23. Грегерсен Дж. П., Рот Б. Инактивация стабильных вирусов в учреждениях для культивирования клеток путем затуманивания надуксусной кислотой. Биологические препараты. 2012; 40: 282–7. pmid: 22424718
  24. 24. Верро Д., Муано С., Дюшен С. Методы отбора проб вирусов, переносимых по воздуху. Microbiol Mol Biol Rev.2008; 72: 413–44. pmid: 18772283
  25. 25. Тюрджен Н., Тулуза М.Дж., Мартель Б., Муано С., Дюшен К.Сравнение пяти бактериофагов как моделей для исследования вирусных аэрозолей. Appl Environ Microbiol. 2014; 80: 4242–50. pmid: 24795379
  26. 26. Верро Д., Руссо Г. М., Гендрон Л., Массе Д., Муано С., Дюшен С. Сравнение фильтров из поликарбоната и политетрафторэтилена для отбора проб содержащихся в воздухе бактериофагов. Аэрозоль Sci Tech. 2010; 44: 197–201.
  27. 27. Гендрон Л., Верро Д., Вейлетт М., Муано С., Дюшен С. Оценка фильтров для отбора проб и количественного определения аэрозолей фагов РНК.Аэрозоль Sci Tech. 2010; 44: 893–901.
  28. 28. Филпоттс Р.Дж., Томас Р.Дж., Бидхэм Р.Дж., Платт С.Д., Вейл, Калифорния. Цистовирус phi6 как имитатор вируса венесуэльского энцефалита лошадей. Аэробиология. 2010; 26: 301–9.
  29. 29. Yu L, Wen ZB, Li JS, Yang WH, Wang J, Li N и др. Влияние различных растворов для отбора проб на выживаемость бактериофагов при барботажной аэрации. Аэробиология. 2010. 26: 75–82.
  30. 30. Lute S, Aranha H, Tremblay D, Liang D, Ackermann HW, Chu B и др.Характеристика колифага PR772 и оценка его использования для тестирования производительности вирусного фильтра. Appl Environ Microbiol. 2004. 70: 4864–71. pmid: 15294825
  31. 31. Панек М., Кац Д.С. Протокол анализа зубного налета. Протоколы Американского общества микробиологии, Вашингтон, округ Колумбия, www.microbelibrary.org, дата обращения 7 октября 2011 г., 2010 г.
  32. 32. Мох ИЛИ. Методы отбора проб в ингаляционной токсикологии. В: Кулькарни П., Барон П.А., Виллеке К., редакторы. Измерение аэрозолей: принципы, методы и приложения.Третий изд: John Wiley and Sons, Inc .; 2011. с. 785–92.
  33. 33. Turgeon N, Toulouse M-J, Ho J, Li D, Duchaine C. Нейраминидаза как ферментативный маркер для обнаружения переносимого по воздуху вируса гриппа и других вирусов. Может J микробиол. 2016.
  34. 34. Верро Д., Дюшен С., Марку-Вуазель М., Тюржон Н., Рой С.Дж. Дизайн вращающейся камеры с контролируемой средой для исследований старения биоаэрозолей. Вдыхать токсикол. 2014; 26: 554–8. pmid: 25055842
  35. 35.Элажари М.А., Дербишир JB. Аэрозольная стабильность аденовируса крупного рогатого скота типа 3. Can J Comp Med. 1979; 43: 305–12. pmid: 226247
  36. 36. Lowen AC, Mubareka S, Steel J, Palese P. Передача вируса гриппа зависит от относительной влажности и температуры. PLoS Pathog. 2007; 3: e151.
  37. 37. Сталь Дж., Палезе П., Лоуэн А.С. Передача вируса пандемического гриппа 2009 г. проявляет чувствительность к температуре и влажности, аналогичную чувствительности сезонного штамма h4N2.J Virol. 2011; 85: 1400–2. pmid: 21084485
  38. 38. Longest PW, Spence BM, Holbrook LT, Mossi KM, Son Y-J, Hindle M. Производство ингаляционных субмикронных аэрозолей из обычных сетчатых небулайзеров для улучшения доставки лекарств через дыхательные пути. J Aerosol Sci. 2012; 51: 66–80. pmid: 22707794

Устойчивость аэрозольных бактериальных вирусов к относительной влажности и температуре

Appl Environ Microbiol. 2015 окт; 81 (20): 7305–7311.

, a , a , a , b, c и a, c

Daniel Verreault

a Center de Recherche de l’Institut Universologie de Pneumologie de Québec, Квебек, Квебек, Канада

Mélissa Marcoux-Voiselle

a Centre de Recherche de l’Institut Universitaire de Cardiologie et de Pneumologie de Québec, Квебек, город, Квебек, Канада

, Квебек, Канада

a Centre de Recherche de l’Institut Universitaire de Cardiologie et de Pneumologie de Québec, Квебек, Квебек, Канада

Sylvain Moineau

b Département de Biochimie, de Microbiologé Sciences, et de de departement de Biochimie, de Microbiologé Sciences, et de de Bio-Informatique et de Génie, Université Laval, Quebec City, Quebec, Canada

c Справочный центр Феликса д’Эрелля по бактериальным вирусам и GREB, Faculté de Médecine Dentaire, Université Laval, Quebec City, Quebec, Canada

Caroline Duchaine

a Centre de Recherche de l’Institut Universitaire de Cardiologie et de Pneumologie de Québec, Квебек, Квебек, Канада

c Félix Центр бактериальных вирусов и GREB, Faculté de Médecine Dentaire, Université Laval, Квебек, Квебек, Канада

D.W. Schaffner, Editor

a Centre de Recherche de l’Institut Universitaire de Cardiologie et de Pneumologie de Québec, Квебек, Квебек, Канада

b Département de Biochimie, de Microbiologie, et de de la Faculté des Sciences et de Génie, Université Laval, Quebec City, Quebec, Canada

c Справочный центр Félix d’Hérelle по бактериальным вирусам и GREB, Faculté de Médecine Dentaire, Université Laval, Квебек, , Канада 9006 Корреспондент. Citation Verreault D, Marcoux-Voiselle M, Turgeon N, Moineau S, Duchaine C. 2015. Устойчивость аэрозольных бактериальных вирусов к относительной влажности и температуре. Appl Environ Microbiol 81: 7305–7311. DOI: 10.1128 / AEM.02484-15.

Поступило 31 июля 2015 г .; Принято 2 августа 2015 г.

Copyright © 2015, Американское общество микробиологии. Все права защищены. Эту статью цитировали в других статьях в PMC.

Abstract

Использование аэрозольных бактериофагов в качестве заменителей опасных вирусов может упростить и ускорить обнаружение связей между вирусными компонентами и их устойчивостью в переносимом воздухе в различных условиях окружающей среды.В этом исследовании четыре структурно различных литических фага, MS2 (одноцепочечная РНК [оцРНК]), ϕ6 (двухцепочечная РНК [дцРНК]), ϕX174 (одноцепочечная ДНК [оцДНК]) и PR772 (двухцепочечная ДНК. [дцДНК]), распыляли во вращающуюся камеру и подвергали воздействию различных уровней относительной влажности (RH) и температуры, а также бактерицидному УФ-излучению. Аэрозольным вирусным частицам позволяли оставаться в воздухе в течение до 14 часов, после чего отбирали пробы для анализа с помощью бляшек и количественной ПЦР.Фаги ϕ6 и MS2 были наиболее устойчивыми при низких уровнях относительной влажности, тогда как ϕX174 были более устойчивыми при относительной влажности 80%. Фаг ϕ6 терял инфекционность сразу после воздействия 30 ° C и относительной влажности 80%. Инфекционность всех протестированных фагов быстро снижалась в зависимости от времени воздействия УФС-излучения, причем фаг MS2 был наиболее устойчивым. Взятые вместе, наши данные показывают, что эти аэрозольные фаги по-разному ведут себя в различных условиях окружающей среды, и подчеркивают необходимость тщательного выбора имитаторов вируса в исследованиях биоаэрозолей.

ВВЕДЕНИЕ

Человеческое население постоянно подвергается воздействию вирусных частиц, будь то через прямые или косвенные контакты с инфицированным человеком или через загрязненную окружающую среду. Несмотря на меры предосторожности, мы по-прежнему подвержены риску воздействия инфекционных вирусных частиц, особенно воздушно-капельным путем. Этот способ передачи трудно контролировать в повседневной жизни из-за повсеместного распространения переносимых по воздуху частиц, которые могут содержать инфекционные материалы. Хотя воздушный путь – не самый эффективный способ передачи большинства известных патогенов человека, многие вирусы могут передаваться этим путем (1).Например, вирусы кори, ветряной оспы (2) и натуральной оспы (3) передаются через аэрозоли. Другие вирусы, такие как вирус болезни Ньюкасла, особенно устойчивы к аэрозолизации и потенциально могут вызывать инфекции аэрозольным путем (4, 5). С другой стороны, важность аэрозольной передачи в распространении некоторых вирусов, таких как вирус гриппа, все еще является предметом дискуссий (6).

Аэрозольные частицы могут быть вовлечены в передачу вируса на близком расстоянии через загрязнение фомитов путем быстрого осаждения крупных капель.Однако истинное распространение аэрозоля предполагает, что достаточно мелкие инфекционные частицы остаются в воздухе в течение длительного периода (2). Частицы с аэродинамическим диаметром менее 5 мкм могут перемещаться на большие расстояния, поскольку они осаждаются медленнее. Однако эти более мелкие частицы содержат меньше вирусов, чем более крупные частицы, но также и меньше материала, который может защитить вирусы в воздушно-капельном состоянии. Действительно, устойчивость вирусов к аэрозолизации частично зависит от состава капель или ядер капель (5, 7, 8).Кроме того, устойчивость вирусов к аэрозолизации, по-видимому, уникальна для каждого вируса (5, 9, 10), хотя, основываясь на очень ограниченных данных, некоторые сходства, такие как наличие или отсутствие оболочки, существуют между вирусами со схожими структурными особенностями. компоненты (11).

Лабораторная работа с патогенами требует соответствующих процедур биоконфайнмента, в зависимости от классификации биобезопасности каждого вируса. Когда патогены распыляются в высоких концентрациях, необходимо принимать дополнительные меры безопасности, что усложняет исследования.Использование непатогенных суррогатных вирусов может помочь облегчить исследования аэрозолей. Хотя очевидно, что ни один вирусный суррогат не может с идеальной точностью имитировать реактивность всех переносимых по воздуху вирусов в их среде, характеристика панели суррогатов может помочь установить некоторые общие рекомендации, которые помогут предсказать реактивность некоторых переносимых по воздуху вирусов.

Бактериальные вирусы или фаги использовались в различных областях в качестве вирусных моделей, но их потенциал в аэробиологии использовался недостаточно.Воздушные фаги изучались в основном для тестирования фильтров (12), для фаговой терапии (13) и в качестве суррогатов в исследованиях биозащиты (14). Фаг MS2 наиболее часто использовался в этих исследованиях вирусных аэрозолей. Хотя фаги специфичны для своего бактериального хозяина, они имеют некоторое сходство с эукариотическими вирусами. А именно, они могут иметь оболочку или нет и могут содержать одно- или двухцепочечный геном РНК или ДНК, который может быть сегментированным, линейным или кольцевым, а вирусные капсиды существуют во множестве форм и размеров (15).Фаги можно безопасно амплифицировать до высоких концентраций по невысокой цене. Интересно, что фаги даже принимаются Ассоциацией парентеральных лекарств (PDA) и Целевой группой по вирусным фильтрам, как опубликовано в обновлении за 2008 г. 41-го технического отчета КПК (16).

В предыдущем исследовании мы исследовали устойчивость к аэрозолизации и взятию проб воздуха нескольких фагов (MS2, PR772, ϕ6, ϕX174 и PM2), которые были выбраны из-за некоторого сходства (размер вириона, состав нуклеиновой кислоты и оболочка) с патогенными вирусами (5).Здесь мы исследовали инфекционность фагов после воздействия стресса окружающей среды в воздушно-капельном состоянии с использованием недавно разработанной вращающейся камеры окружающей среды (17). Четыре фага распыляли при различных температурах и уровнях относительной влажности (RH) и подвергали воздействию УФ-излучения.

МАТЕРИАЛЫ И МЕТОДЫ

Бактериофаги.

Фаги, использованные в этом исследовании, описаны в. Фаги ϕ6 (HER 102), ϕX174 (HER 36) и PR772 (HER 221) и их соответствующие бактериальные штаммы-хозяева, Pseudomonas syringae HER 1102, Escherichia coli HER 1036 и E.coli HER 1221, были предоставлены Справочным центром бактериальных вирусов Феликса д’Эрелля (www.phage.ulaval.ca). Фаг MS2 (ATCC 15597-B1) и его хозяин, E. coli (ATCC 15597), были получены через Американскую коллекцию типовых культур (ATCC).

ТАБЛИЦА 1

Описание бесхвостых фагов, использованных в данном исследовании

Фаг Семейство фагов В оболочке Характеристики генома a Бактериальный хозяин Инкубация
MS2 Leviviridae оцРНК, линейная, 3569 нуклеотидов E.coli 37
ϕ6 Cystoviridae Да дцРНК, линейная, сегментированная, 13,385 п.н. № дцДНК, линейная, 14,492 п.н. E. coli 37
ϕX174 Microviridae оцДНК E.coli 37

Фаги MS2 и ϕX174 размножали в жидких культурах на их соответствующих хозяевах, как описано ранее (9, 10). Фаг PR772 размножался на своем хозяине на триптическом соевом бульоне (TSB) с добавлением агарозы (0,75%), как сообщается в другом месте (18). Фаг ϕ6 размножали на своем бактериальном хозяине на мягком агаре TSB (0,75%), как описано ранее (10), но с небольшими изменениями. Вкратце, жидкий препарат TSB с добавлением 0,75% агара инокулировали ночной культурой P.Широковые . Исходную суспензию ϕ6 добавляли к засеянной среде и выливали на чашки с трипсиновым соевым агаром (TSA). Затем планшеты инкубировали в течение ночи при 25 ° C, и планшеты с почти конфлюэнтной БОЕ отбирали для экстракции фага. Мягкий агар соскребали с планшетов и переносили в пробирки, содержащие 5 мл фагового буфера (20 мМ трис-HCl [pH 7,4], 100 мМ NaCl, 10 мМ MgSO 4 ). Пробирки помещали при медленном перемешивании на 6 часов. Крупный мусор удаляли центрифугированием при 2800 × g в течение 10 мин, и супернатант фильтровали (0.45 мкм) и выдерживали при 4 ° C до использования. Амплификации фага дали приблизительно 10 10 БОЕ / мл, как определено анализами бляшек (19).

Аэрозольная камера.

Технические характеристики и подробное описание аэрозольной камеры, использованной в этом исследовании, доступны в другом месте (17). Вкратце, аэрозольная камера представляет собой вращающийся алюминиевый барабан объемом 55,5 л, защищенный внутри изолированного корпуса с регулируемой температурой. Температура внутри вращающейся камеры регулируется путем регулирования температуры внутри изолированного корпуса с помощью двух термоэлектрических сборок (модель INB340-24-AA; Watronix, Inc., West Hills, CA) для охлаждения или обогрева. Оба конца цилиндрической камеры закрыты колпачками, изготовленными по индивидуальному заказу, установленными на шарикоподшипниках с двойным уплотнением. Внутренние части подшипников остаются неподвижными во время вращения барабана и удерживают выступающие алюминиевые стержни с несколькими отверстиями, доступ к которым осуществляется снаружи изолированного корпуса. В левом колпачке в центре вращения находится УФ-светильник с длиной волны 254 нм (модель GCL356T5L / 4P; Light Sources, Inc., Orange, CT), а также УФ-датчик (модель UV-Air; sglux SolGel Technologies GmbH, Берлин. , Германия) на расстоянии 5 см от источника света.Датчик температуры и относительной влажности (RH) (модель RH-USB; Omega), помещенный во вращающуюся камеру через порт доступа, и идентичный датчик, помещенный внутри изолированной коробки, использовались для мониторинга и регистрации значений температуры и уровней относительной влажности в режиме реального времени на протяжении всей камеры. эксперименты. Скорость вращения камеры была установлена ​​на 1 оборот в минуту (об / мин) на протяжении всех экспериментов.

Создание аэрозолей и протокол отбора проб.

Фаговый буфер использовали для приготовления жидкости для образования аэрозоля.Свежие лизаты четырех фагов добавляли к буферу до конечного титра от 10 8 до 10 9 БОЕ / мл. Пять микролитров концентрированного пеногасителя A (A5633; Sigma-Aldrich) добавляли к конечному объему 50 мл каждой суспензии, приготовленной для образования аэрозоля. Аэрозолизацию проводили с использованием 6-струйного небулайзера Коллисона (BGI Inc., Уолтем, Массачусетс), в который подавали медицинский фильтрованный сухой воздух со скоростью 12 л / мин и давлением 20 фунтов / дюйм 2 манометров. на 10 мин.

Сразу после распыления использовали аэродинамический измеритель размера частиц (APS) (модель 3321; TSI, Inc.), оборудованный разбавителем 1/100 (модель TSI 3302A), для сбора данных при скорости потока 5 л / мин в течение 20 минут. с. Затем насос APS был выключен, и вращающаяся камера была герметизирована. BioSampler (SKC, Inc., Eighty Four, PA), заполненный 20 мл фагового буфера, использовали для отбора проб аэрозолей из барабана со скоростью 12,5 л / мин в течение 20 мин. По сути, все аэрозольное содержимое камеры было сконцентрировано в одном образце, что позволило максимально детектировать инфекционные вирусные частицы.Каждый собранный образец аэрозоля соответствовал отдельному протоколу распыления. Для каждого условия окружающей среды, описанного ниже, образцы аэрозоля отбирались через 5 минут, 6 часов и 14 часов времени суспендирования, а воздух во вращающейся камере продувался после каждого образца. Образец в момент времени, соответствующий нулевому часу приостановки, был взят сразу после получения APS. Отбор образцов в моменты времени 0, 6 и 14 ч всегда проводился последовательно с использованием одной и той же жидкости для образования аэрозоля.Каждое условие окружающей среды анализировали в трех или более экземплярах. Образцы аэрозоля хранили при 4 ° C до анализа, а анализы на инфекционность выполняли в течение 3 часов после отбора образцов.

Влияние относительной влажности и температуры на переносимых по воздуху фагов.

Чтобы оценить влияние температуры и относительной влажности на инфекционность переносимых по воздуху фагов, уровни относительной влажности 20% (низкий) и 50% (средний) были проанализированы при 18 ° C, тогда как относительная влажность 80% была определена при 18 ° C. С и 30 ° С. Желаемые уровни относительной влажности были получены путем пропускания аэрозоля через различные трубы, заполненные влагопоглотителем (17).При 18 ° C, 20% RH было получено путем пропускания аэрозоля через 60 дюймов осушителя, 50% RH было получено через 36 дюймов, и 80% RH было получено через 12 дюймов. Чтобы достичь 80% RH при 30 ° C, вместо эксикаторов использовался дополнительный источник увлажненного воздуха. Воздух внутри вращающейся камеры увлажнялся через отдельный входной порт одновременно с распылением вирусов.

Влияние ультрафиолетового излучения на фагов, переносимых по воздуху.

Ртутная лампа низкого давления UVC с длиной волны 254 нм внутри барабана использовалась для оценки воздействия УФ-излучения на целостность переносимых по воздуху вирусов.Как указано выше, зонд УФ-датчика был размещен на расстоянии 5 см от источника, чтобы обеспечить повторяемость результатов между экспериментами. Препараты фагов распыляли в барабан, как описано выше. Камеру герметично закрывали, и аэрозолю давали стабилизироваться во вращающейся камере в течение 15 мин. Температура внутри камеры поддерживалась на уровне 18 ° C при относительной влажности 20%. Затем УФ-свет включали на период 3, 6 или 10 с; также выполнялись контроли без воздействия УФС. Образцы аэрозоля отбирали через 1 мин после УФ-облучения с помощью прибора BioSampler, как описано выше.

Анализ зубного налета.

Анализы бляшек проводили в соответствии со стандартными протоколами с использованием жидкого TSB (0,75% агар). Жидкость BioSampler анализировали неразбавленной и серийно разбавляли фаговым буфером. Каждый образец аэрозоля анализировали на всех четырех бактериальных хозяевах и инкубировали в течение ночи при оптимальной температуре для каждого бактериального штамма. Инфекционные титры вирусов рассчитывали как количество БОЕ на миллилитр собираемой жидкости BioSampler.

Извлечение РНК и синтез кДНК.

Экстракции

РНК из фагов MS2 и ϕ6 проводили с использованием мини-набора для вирусной РНК QIAamp (Qiagen Canada Inc., Mississauga, ON, Canada) без РНК-носителя, как описано в другом месте (10). Перед синтезом кДНК образцы экстрагированной РНК подвергали термообработке при 110 ° C в течение 5 минут и помещали на лед; этот шаг был выполнен для денатурирования сегментов двухцепочечной РНК (10). Затем кДНК синтезировали с использованием набора для синтеза кДНК iScript (Bio-Rad Laboratories, Hercules, CA) в соответствии с протоколом производителя.Реакционная смесь состояла из 5 мкл образца РНК, 4 мкл реакционной смеси 5 × iScript (Bio-Rad), 1 мкл обратной транскриптазы iScript (Bio-Rad) и 10 мкл воды, свободной от нуклеаз.

Анализ КПЦР.

Праймеры и зонды, используемые для количественного анализа ПЦР (qPCR), описаны в. Все кПЦР выполняли с помощью системы обнаружения ПЦР в реальном времени DNA Engine Opticon 2 (Bio-Rad). Образцы анализировали с помощью программного обеспечения Opticon Monitor (версия 2.02.24; Bio-Rad). Смесь для ПЦР содержала 1-кратную конечную концентрацию iQ Supermix (Bio-Rad) и 1 мкМ прямой и обратный праймеры.Концентрации зонда составляли 150 нМ, 300 нМ, 200 нМ и 200 нМ для MS2 (10), ϕ6 (10), ϕX174 (9) и PR772 (5), соответственно. Этот раствор мастер-микса распределяли аликвотами по 23 мкл / лунку для фагов ϕ6 и MS2 и аликвотами по 20 мкл / лунку для PR772 и ϕX174 в 96-луночных планшетах. Тестовые образцы объемом два микролитра были добавлены для ϕ6 и MS2 и 5 мкл образцов для PR772 и ϕX174, до конечного объема 25 мкл. Протокол qPCR для ϕX174, PR772 и MS2 составлял 94 ° C в течение 3 минут (горячий старт) с последующими 40 циклами при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд.Протокол для ϕ6: 94 ° C в течение 3 минут (горячий старт), затем 40 циклов при 95 ° C в течение 20 с и 60 ° C в течение 60 с. Все анализы qPCR были выполнены в двух экземплярах. Для каждого фага была приготовлена ​​специфическая плазмида; целевой генный сегмент был клонирован в TOPO (Invitrogen, Carlsbad, CA) и очищен с использованием набора QIAprep Spin miniprep (Qiagen, Inc.) (5, 9, 10). Плазмиды количественно определяли путем определения оптической плотности при 260 нм, и для построения стандартных кривых использовали серийные разведения с известными концентрациями.

ТАБЛИЦА 2

Праймеры и зонды, используемые для кПЦР и кПЦР в реальном времени

64 5′-GTCCATACCTTAGATGCGTTAGC-3 ‘ 90CCG12 906 92 906 Инфекционный вирус 906

Количество БОЕ, обнаруженных в каждом образце, было разделено на количество фаговых геномов, обнаруженных в том же объеме образца. Полученную фракцию умножали на 100, чтобы получить процент вирусных геномов, связанных с PFU.

Статистический анализ.

Результаты для количественных и номинальных переменных выражаются как среднее ± стандартное отклонение (SD) и проценты, соответственно. Двухфакторный дисперсионный анализ (ANOVA) был проведен для сравнения между группами и температурой или различной относительной влажностью.Исходя из остатков статистической модели, предположение о нормальности было проверено с помощью теста Шапиро-Уилка, а вариации Брауна и Форсайта статистического критерия Левена использовались для проверки однородности дисперсий. Для всех переменных графический анализ остатков с предсказанными значениями выявил взаимосвязь между дисперсиями наблюдений и средними значениями для этих переменных. Для оценки формы требуемого преобразования, связанного с этими переменными, был использован подход регрессии между логарифмом стандартных отклонений и логарифмом средних значений из различных условий.Логарифмическое преобразование было подходящим, и статистические результаты по этим параметрам выражаются с помощью значений, преобразованных в логарифмический формат. Когда эти предположения не были выполнены после преобразования журнала, была выполнена альтернативная процедура, которая не зависит от этих предположений. В этой процедуре наблюдения были заменены их рангом, называемым ранговым преобразованием, и был применен обычный тест F из двустороннего дисперсионного анализа. Этот метод дает приблизительные результаты, но имеет хорошие статистические свойства по сравнению с точными тестами.Когда обе процедуры (логарифмически преобразованные данные и ранги) дали одинаковые результаты, результаты стандартного анализа были сохранены. Когда результаты обеих процедур различались, предпочтение было отдано преобразованию рангов. При необходимости было выполнено апостериорное сравнение с использованием метода Тьюки.

Влияние УФ-облучения на инфекционность аэрозольных бактериофагов было проанализировано с использованием смешанной модели на логарифмически преобразованных данных. Были определены три экспериментальных фактора: один связан с фагами (фиксированный фактор с четырьмя уровнями), один – с образцами (случайный фактор), а третий – со временем (фиксированный фактор с тремя уровнями).Последний был проанализирован как фактор повторных измерений с использованием симметричной ковариационной структуры. Данные были проанализированы с использованием линейной смешанной модели со сроком взаимодействия между фиксированными факторами. Статистическая модель была приспособлена для сравнения фагов с неоднородными вариациями и проверена на предмет того, может ли она быть сведена к статистической модели с той же вариацией между фагами. Поскольку эффект, определяющий неоднородность ковариационной структуры, был значительным (гетероскедастичность) по сравнению с эффектом такой же дисперсии среди фагов, статистический анализ выполняли с использованием отдельной остаточной ковариационной структуры для каждого фага.Остаточное максимальное правдоподобие использовалось в качестве метода оценки, а метод Кенварда-Роджера использовался для оценки степеней свободы знаменателя для теста фиксированных эффектов. Апостериорные сравнения были выполнены с использованием метода Тьюки. Предположение о нормальности было проверено с помощью тестов Шапиро-Уилка на распределение ошибок из факторизации Холецкого статистической модели. Результаты считались значимыми, если значения P были ≤0,05. Данные были проанализированы с помощью статистического пакета программы SAS (версия 9.4; SAS Institute, Inc., Кэри, Северная Каролина).

РЕЗУЛЬТАТЫ

Физические характеристики аэрозолей.

Концентрации частиц после образования аэрозоля составляли от 1,1 × 10 5 до 1,7 × 10 5 частиц / см 3 , как было определено аэродинамическим измерителем размеров частиц. Средневзвешенный аэродинамический диаметр (MMAD) сразу после распыления составлял 1,12 ± 0,05 мкм. Изменения концентрации частиц и MMAD во времени внутри камеры были описаны ранее (17).

Измерение температуры и относительной влажности.

Эффекты RH (20%, 50% и 80%) на переносимых по воздуху фагов оценивались при 18 ° C. Зарегистрированная температура составляла 17,6 ± 0,3 ° C, а уровни относительной влажности незначительно варьировались внутри и между экспериментами. Уровни относительной влажности поддерживались между 19,6% и 25,0% для экспериментов с относительной влажностью 20%, между 46,6% и 52,7% для условий относительной влажности 50% и между 75,0% и 80,3% для условий относительной влажности 80%. Когда предполагаемая температура 30 ° C и уровень относительной влажности 80% были оценены, фактическая температура составила 29.3 ± 0,6 ° C, а относительная влажность колебалась от 79,1% до 85,0%. Для упрощения текста уровни относительной влажности будут обозначаться как 20%, 50% и 80%, а температуры будут обозначаться как 18 ° C и 30 ° C.

Влияние относительной влажности на инфекционность переносимых по воздуху фагов.

Аэрозольные частицы поддерживались во вращающейся аэрозольной камере в течение 0, 6 и 14 часов при 18 ° C и уровнях относительной влажности 20%, 50% или 80%. Образцы аэрозоля анализировали с помощью анализа бляшек и количественной ПЦР, и рассчитывали процентное содержание вирусных геномов, связанных с инфекционными вирусными частицами.Четыре фага были инфицированы через 0 ч воздействия при всех RH. Влияние RH на инфекционность четырех протестированных фагов проиллюстрировано в.

Влияние относительной влажности и времени суспендирования аэрозоля на инфекционность фага. Эксперименты проводились при 18 ° C с различной относительной влажностью. Коэффициенты инфицированности через 6 и 14 часов воздействия сравнивали с коэффициентом инфицирования через 0 часов для расчета относительного коэффициента инфицирования. Пунктирная линия указывает опорное значение в нулевой момент времени. Звездочка указывает на существенное отличие от эталонного значения ( P <0.05), а a и b указывают на значительные различия между относительными инфекционными соотношениями при разных RH. Контрольное значение (нулевой момент времени) было ниже предела обнаружения фага ϕ6 при 20% и 80% относительной влажности для одного из трех повторов и при 50% для двух из четырех повторов.

Фаг ϕX174 показал лучшую устойчивость при относительной влажности 80%, как через 6, так и через 14 часов воздействия, чем при 20% и 50% ( P <0,05). Фагу PR772 требуется высокий уровень относительной влажности, чтобы противостоять ему в воздухе, поскольку инфекционные частицы PR772 не наблюдались после 6 и 14 часов воздействия при относительной влажности 20% и после 14 часов воздействия при относительной влажности 50%.Была значительная разница между 6-часовым и 14-часовым воздействиями и контрольной точкой воздействия 0 часов для всех уровней относительной влажности. С другой стороны, фаг ϕ6 лучше сопротивляется при более низкой относительной влажности (20%, P <0,05), чем при более высокой относительной влажности (50% и 80%). Частицы инфекционного фага ϕ6 не были обнаружены после 6 и 14 часов воздействия 50% относительной влажности и после 14 часов воздействия 80%. Наконец, фаг MS2 был высокостабильным во всех испытанных условиях относительной влажности, но был значительно более устойчивым в состоянии аэрозоля при относительной влажности 20% ( P <0.05).

Влияние температуры на инфекционность переносимых по воздуху фагов.

Фагосодержащие аэрозоли подвергались воздействию в течение 0, 6 или 14 ч при 18 или 30 ° C и постоянной относительной влажности 80% (). Бляшки наблюдали для всех фагов в нулевой момент времени, за исключением ϕ6, который не образовывал никаких бляшек после аэрозолизации при 30 ° C. Фаг ϕX174 был устойчив к обеим температурам, но лучше сопротивлялся при 18 ° C ( P <0,05), хотя инфекционная способность ϕX174 снижалась через 14 часов воздействия ( P <0.05). Фаг PR772 был чувствителен к обеим температурам, так как его относительная инфекционность после 6-часовой и 14-часовой экспозиции была значительно ниже, чем в контрольное время, 0 часов. При относительной влажности 80% фаг ϕ6 был заметно нестабилен через 0, 6 или 14 часов при обеих температурах. Наконец, фаг MS2 был стабилен в течение 6 часов воздействия при обеих температурах, но его инфекционность снизилась после 14 часов воздействия при 30 ° C ( P <0,05).

Влияние температуры и времени аэрозольной суспензии на инфекционность фага.Эксперименты проводились при относительной влажности 80% при двух температурах. Коэффициенты инфицированности через 6 и 14 часов воздействия сравнивали с коэффициентом инфицирования через 0 часов для расчета относительного коэффициента инфицирования. Пунктирная линия указывает опорное значение в нулевой момент времени. Звездочка указывает на существенное отличие от контрольного значения в нулевой момент времени ( P <0,05), а и b указывают на значительные различия между относительными инфекционными соотношениями при разных температурах, а и § указывают на значительное влияние времени воздействия.Контрольное значение (ноль времени) для фага ϕ6 было ниже предела обнаружения при 18 ° C в одной повторности из трех экспериментов. Все точки данных (включая контрольное значение) при 30 ° C для фага ϕ6 были ниже предела обнаружения.

Устойчивость переносимых по воздуху фагов к УФ.

Фаги распыляли при 18 ° C и относительной влажности 20% и подвергали УФ-свету в течение 0, 3, 6 или 10 с (). Значительный эффект был заметен, начиная с 3-х секунд воздействия ультрафиолета для всех фагов ( P <0,0001). Фаги обладают различной устойчивостью к УФ-излучению.MS2 был значительно более устойчивым, чем другие ( P <0,005), тогда как ϕX174 был наиболее чувствительным.

Влияние УФ-излучения на инфекционность аэрозольных фагов. Эксперименты проводились при 18 ° C и относительной влажности 20%. Коэффициенты заразности через 3, 6 и 10 секунд воздействия сравнивали с коэффициентами заразности при 0 секундах воздействия для расчета относительного заразного отношения. Пунктирная линия указывает опорное значение в нулевой момент времени. a, b и c указывают на значительные различия между уровнями устойчивости фагов к УФ ( P <0.05), а символы § и # указывают на значительное влияние времени воздействия УФ-излучения.

ОБСУЖДЕНИЕ

Целью данного исследования было сравнить влияние условий окружающей среды на целостность четырех структурно и генетически различных непатогенных фагов в аэрозолях. Четыре бесхвостых фага, включая MS2, который часто используется в качестве заменителя эукариотических вирусов, распыляли во вращающейся камере и подвергали воздействию различных условий окружающей среды. Их инфекционная способность измерялась сразу после распыления, а также через 6 и 14 часов выдержки в контролируемых условиях температуры, относительной влажности и УФ-излучения.Все четыре фага распыляли и отбирали пробы одновременно, тем самым ограничивая переменные природой вирусов. Чтобы рассматривать время или состояние в воздухе как переменный фактор, коэффициенты заразности, полученные после 6 и 14 часов аэрозольной суспензии, сравнивали с коэффициентами заразности, полученными в нулевой момент времени. Уровни чувствительности к условиям окружающей среды значительно различались от одного фага к другому, и их поведение обобщено в. Фаг ϕ6 был очень чувствителен к нескольким тестовым условиям.Следовательно, было получено мало точек данных, и результаты следует интерпретировать с осторожностью.

ТАБЛИЦА 3

Поведение аэрозольных фагов при различных условиях окружающей среды a

Фаг Тип праймера и зонд Последовательность a Ссылка
10
обратный 5′-CCGTTAGCGAAGTTGCTTGG-3′
ACTC642 FCCA1 ACC641 90CC2 ϕ6 Вперед 5′-TGGCGGCGGTCAAGAGC-3 ‘ 10
Обратный 5′-GGATGATTCTCCAGAAGCTGCTG-3′ 90GACCACCTG-3 ‘ 90GACQAC 906GACCTG-3′ 90GACQAC 906GAC
PR772 Вперед 5′-CCTGAATCCGCCTATTATGTTGC-3 ‘ 5
Обратный 5′-TTTTA ACGCATCGCCAATTTCAC-3 ‘
Зонд 5′-FAM-CGCATACCAGCCAGCACCATTACGCA / IABlk_FQ-3′
φX174 Форвард 5′-ACAAAGTTTGGATTGCTACTGACC-3 ‘
Обратный 5′-CGGCAGCAATAAACTCAACAGG-3 ‘
Зонд 5′-FAM-CTCTCGTGCTCGTCGCTGCGTTGA / BHQ_1-3′
Фаг Поведение при температуре:
Поведение при относительной влажности 22:
906 УФ-свет
18 ° C 30 ° C 20% 50% 80%
MS2 + + + + +++
ϕ6 ND + ND ++
PR772 ND +
ϕX174 + + +

MS2 – самый устойчивый фаг, используемый в его исследование.Этот фаг был стабильным при всех тестируемых уровнях относительной влажности и температуры. Он также продемонстрировал более высокий уровень устойчивости к бактерицидному УФ-излучению. MS2 широко используется, потому что он непатоген, прост в использовании и может достигать высоких титров за короткое время. Устойчивость этого вируса делает его хорошим выбором для различных исследований, когда необходимы высокостабильные вирусы. Предыдущие исследования показали, что распыление или отбор проб не влияет на инфекционность фага MS2 (5, 20, 21).Хотя он может быть хорошим суррогатным кандидатом для некоторых исследований аэрозолей, его устойчивость к некоторым стрессовым факторам, таким как УФ-облучение, также указывает на то, что он не всегда может быть лучшим представителем. Например, было показано, что аденовирусы более устойчивы к УФ-облучению, чем MS2 (22, 23). Следовательно, следует тестировать другие фаговые модели для определения подходящих суррогатов. Примечательно, что воздействие бактерицидного УФ-излучения на переносимые по воздуху вирусы может помочь понять, насколько эффективны системы УФ-обработки воздуха для инактивации вирусных частиц.Однако, поскольку эти длины волн в естественных условиях не присутствуют на поверхности Земли, потребуется другая УФ-лампа, чтобы охарактеризовать стабильность переносимых по воздуху вирусов во внешней среде.

Фаг в оболочке ϕ6 был более устойчивым к более низким уровням RH, что согласуется с некоторыми наблюдениями, предполагающими, что вирусы в оболочке, такие как вирус гриппа, более устойчивы к более сухим и прохладным условиям (11). Тем не менее, подобные структурные компоненты не предсказывают вирусную резистентность.Фаг MS2, не имеющий оболочки, также был стабильным при более низких уровнях RH. Это подчеркивает многофакторный характер устойчивости вирусов к стрессам окружающей среды.

Распыляющая жидкость также может влиять на результаты исследований устойчивости к аэрозолям. Было высказано предположение, что присутствие белков в среде для распыления может защитить целостность переносимых по воздуху вирусов, по крайней мере, для фагов MS2 (21), ϕ6 и PR772 (5). Здесь мы использовали фаговый буфер из смеси солей.Содержание белка ограничивалось фаговым белком и в основном остаточными белками, содержащимися в отфильтрованных фаговых лизатах, используемых для приготовления пробы для распыления. Таким образом, мы предполагаем, что этот защитный эффект был ограничен в нашем исследовании из-за низкого содержания белка. Поскольку использованные вирусы распылялись одновременно, частицы, переносимые по воздуху, подвергались воздействию солей и белков одинаковых концентраций. Таким образом, полученные данные относятся к исследуемому фагу и условиям.

Помимо жидкости для распыления, другими возможными факторами, которые могут повлиять на вирусную инфекционность при исследованиях аэрозолей, являются процедуры распыления и отбора проб.Хотя на инфекционность фага MS2 распыление и взятие проб существенно не повлияло (5, 19, 21), это может не быть репрезентативным для всех вирусов. Действительно, различия в структурных компонентах, включая наличие или отсутствие оболочки или выступающих структур, могут иметь значительное влияние на уязвимость переносимых по воздуху вирусов для окружающей среды. Сообщалось о различиях в чувствительности между подтипами вируса гриппа (24), предполагая, что даже незначительные структурные различия могут влиять на вирусную инфекционность.Наши результаты ясно показывают, что фаги могут обладать разными уровнями устойчивости к различным условиям окружающей среды. Имея это в виду и учитывая доступность коллекций фагов, весьма возможно найти фаг или набор фагов с поведением в воздухе, аналогичным поведению интересующего вируса.

Растет интерес к краткосрочной и долгосрочной судьбе переносимых по воздуху вирусов и их способности вызывать инфекцию после длительного воздействия факторов стресса окружающей среды.Одной из основных ловушек для получения достаточного количества данных для начала разработки некоторых общих схем, связывающих вирусные структуры с их устойчивостью в воздухе, является сложность изучения патогенных вирусов в стандартных лабораторных условиях. По нашему мнению, использование фагов является хорошим компромиссом для установления некоторых общих рекомендаций без необходимости применения передовых мер биобезопасности. Кроме того, фаги имеют дополнительное преимущество в том, что они менее дороги и менее трудоемки для амплификации, чем эукариотические вирусы.В настоящее время список изученных вирусов, переносимых по воздуху, ограничен и позволяет только очень консервативные прогнозы чувствительности вирусов к условиям, встречающимся в состоянии аэрозоля. Лучшее понимание условий, влияющих на инфекционность вирусов в зависимости от их структурных компонентов, поможет в разработке алгоритмов оценки способности данного вируса противостоять различным условиям окружающей среды. Это также, безусловно, приведет к открытию новых решений для эффективного устранения переносимых по воздуху вирусов.Это позволит быстрее принять соответствующие профилактические меры для сведения к минимуму рисков, связанных с распространением переносимых по воздуху вирусных частиц. Взятые вместе, результаты этого исследования обеспечивают основу для изучения устойчивости переносимых по воздуху вирусов, а также дают четкое представление об этом.

БЛАГОДАРНОСТИ

Эта работа финансировалась программой совместных проектов исследований в области здравоохранения NSERC / CIHR. М.М.-В. является стипендиатом НКРЭ. CD. является старшим научным сотрудником FRQ-S и членом сети FRQ-S Respiratory Health Network.С.М. заведует кафедрой исследований бактериофагов Канады уровня 1.

Мы благодарим Справочный центр бактериальных вирусов Феликса д’Эрелля (www.phage.ulaval.ca) за любезно предоставленные бактериофаги. Благодарим Сержа Симара за статистический анализ.

ССЫЛКИ

1. Рой С.Дж., Милтон, округ Колумбия. 2004 г. Передача инфекционных инфекций воздушно-капельным путем – неуловимый путь. N Engl J Med 350: 1710–1712. DOI: 10.1056 / NEJMp048051. [PubMed] [CrossRef] [Google Scholar] 2. Тан Дж. У., Ли Й, Имс И., Чан П. К., Риджуэй Г.Л.2006 г. Факторы, участвующие в аэрозольном переносе инфекции и контроле вентиляции в медицинских учреждениях. J Hosp Infect 64: 100–114. DOI: 10.1016 / j.jhin.2006.05.022. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 3. Milton DK. 2012 г. Каков основной путь передачи оспы? Значение для биозащиты. Микробиол фронтальной клеточной инфекции 2: 150. DOI: 10.3389 / fcimb.2012.00150. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Turgeon N, McNicoll F, Toulouse M-J, Liav A, Barbeau J, Ho J, Grund C, Duchaine C.2011 г. Активность нейраминидазы как потенциального ферментативного маркера для быстрого обнаружения вирусов, переносимых по воздуху. Аэрозоль Sci Technol 45: 183–195. DOI: 10.1080 / 02786826.2010.530624. [CrossRef] [Google Scholar] 5. Тюрджен Н., Тулуза М.Дж., Мартель Б., Муано С., Дюшен К. 2014 г. Сравнение пяти бактериофагов как моделей для исследования вирусных аэрозолей. Appl Environ Microbiol 80: 4242–4250. DOI: 10.1128 / AEM.00767-14. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. La Rosa G, Fratini M, Della Libera S, Iaconelli M, Muscillo M.2013. Вирусные инфекции, передаваемые в помещении воздушно-капельным или контактным путем. Энн Ист Супер Санита 49: 124–132. [PubMed] [Google Scholar] 7. Филпоттс Р.Дж., Томас Р.Дж., Бидхэм Р.Дж., Платт С.Д., Вейл, Калифорния. 2010 г. Цистовирус phi6 как имитатор вируса венесуэльского энцефалита лошадей. Аэробиология 26: 301–309. DOI: 10.1007 / s10453-010-9166-у. [CrossRef] [Google Scholar] 8. Trouwborst T, Kuyper S. 1974 г. Инактивация бактериофага Т3 в аэрозолях: влияние предварительного увлажнения на выживаемость после опрыскивания из растворов соли, пептона и слюны.Appl Microbiol 27: 834–837. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Верро Д., Руссо Г. М., Жендрон Л., Массе Д., Муано С., Дюшен К. 2010 г. Сравнение фильтров из поликарбоната и политетрафторэтилена для отбора проб бактериофагов в воздухе. Аэрозоль Sci Technol 44: 197–201. DOI: 10.1080 / 027868208899. [CrossRef] [Google Scholar] 10. Гендрон Л., Верро Д., Вейлетт М., Муано С., Дюшен С. 2010 г. Оценка фильтров для отбора проб и количественного определения аэрозолей фагов РНК. Аэрозоль Sci Technol 44: 893–901.DOI: 10.1080 / 02786826.2010.501351. [CrossRef] [Google Scholar] 12. Gardner PD, Eshbaugh JP, Harpest SD, Richardson AW, Hofacre KC. 2013. Эффективная вирусная эффективность респираторных фильтров N95 и P100 при постоянном и циклическом потоке. J Occup Environ Hyg 10: 564–572. DOI: 10.1080 / 15459624.2013.818228. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 13. Hoe S, Semler DD, Goudie AD, Lynch KH, Matinkhoo S, Finlay WH, Dennis JJ, Vehring R. 2013. Респирабельные бактериофаги для лечения бактериальных инфекций легких.J Aerosol Med Pulm Drug Deliv 26: 317–335. DOI: 10.1089 / jamp.2012.1001. [PubMed] [CrossRef] [Google Scholar] 14. О’Коннелл К.П., Бухер-младший, Андерсон П.Е., Цао С.Дж., Хан А.С., Гостомски М.В., Вальдес Дж.Дж. 2006 г. Флуорогенные ПЦР с обратной транскрипцией в реальном времени для обнаружения бактериофага MS2. Appl Environ Microbiol 72: 478–483. DOI: 10.1128 / AEM.72.1.478-483.2006. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Акерманн Х.В., Прангишвили Д. 2012 г. Прокариотные вирусы изучены с помощью электронной микроскопии.Арка Вирол 157: 1843–1849. DOI: 10.1007 / s00705-012-1383-у. [PubMed] [CrossRef] [Google Scholar] 16. Целевая группа по фильтрации вирусов. 2008 г. Технический отчет № 41: фильтрация вирусов. Пересмотрено в 2008 г. КПК J Sci Technol 62 (Дополнение S-4): 1–6. [Google Scholar] 17. Верро Д., Дюшен С., Марку-Вуазель М., Тюржон Н., Рой С.Дж. 2014 г. Дизайн вращающейся камеры с контролируемой средой для исследований старения биоаэрозолей. Вдыхать токсикол 26: 554–558. DOI: 10.3109 / 08958378.2014.928763. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18.Lute S, Aranha H, Tremblay D, Liang D, Ackermann HW, Chu B, Moineau S, Brorson K. 2004 г. Характеристика колифага PR772 и оценка его использования для тестирования производительности вирусного фильтра. Appl Environ Microbiol 70: 4864–4871. DOI: 10.1128 / AEM.70.8.4864-4871.2004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Zuo ZL, Kuehn TH, Verma H, Kumar S, Goyal SM, Appert J, Raynor PC, Ge S, Pui DYH. 2013. Связь инфекционности и выживаемости переносимого по воздуху вируса с размером его частиц-носителей.Аэрозоль Sci Technol 47: 373–382. DOI: 10.1080 / 02786826.2012.754841. [CrossRef] [Google Scholar] 21. Zuo Z, Kuehn TH, Bekele AZ, Mor SK, Verma H, Goyal SM, Raynor PC, Pui DY. 2014 г. Выживание переносимого по воздуху бактериофага MS2, полученного из человеческой слюны, искусственной слюны и среды для культивирования клеток. Appl Environ Microbiol 80: 2796–2803. DOI: 10.1128 / AEM.00056-14. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 22. Hijnen WAM, Beerendonk EF, Medema GJ. 2006 г. Кредит инактивации УФ-излучения для вирусов, бактерий и цист простейших (oo) в воде: обзор.Вода Res 40: 3–22. DOI: 10.1016 / j.watres.2005.10.030. [PubMed] [CrossRef] [Google Scholar] 23. Ко G, Cromeans TL, Sobsey MD. 2005 г. УФ-инактивация аденовируса типа 41, измеренная с помощью ОТ-ПЦР мРНК культуры клеток. Вода Res 39: 3643–3649. DOI: 10.1016 / j.watres.2005.06.013. [PubMed] [CrossRef] [Google Scholar] 24. Пьянков О.В., Пьянкова О.Г., Аграновский И.Е. 2012 г. Инактивация вируса гриппа, переносимого воздушно-капельным путем, в окружающем воздухе. J Aerosol Sci 53: 21–28. DOI: 10.1016 / j.jaerosci.2012.05.011. [CrossRef] [Google Scholar]

Устойчивость аэрозольных бактериальных вирусов к четырем бактерицидным продуктам

Abstract

Вирусные заболевания могут распространяться различными путями, включая аэрозоли.Тем не менее, имеются ограниченные данные об эффективности аэрозольных химикатов для снижения вирусной нагрузки в воздухе. Бактериофаги (фаги) часто используются в качестве заменителей опасных вирусов в исследованиях аэрозолей, поскольку они недороги, просты в обращении и безопасны для лабораторных работников. Более того, некоторые из этих бактериальных вирусов обладают физическими характеристиками, сходными с патогенными вирусами человека и животных, такими как морфологический размер, тип нуклеиновых кислот, морфология капсида и наличие оболочки.В этом исследовании эффективность четырех химических веществ оценивалась на четырех переносимых по воздуху фагах при двух различных уровнях относительной влажности. Нехвостые бактериофаги MS2 (одноцепочечная РНК), ϕ6 (двухцепочечная РНК, оболочка), PR772 (двухцепочечная ДНК) и ϕX174 (одноцепочечная ДНК) сначала были распылены в ротационной камере объемом 55 л при 19 °. C при относительной влажности 25% и 50%. Затем перекись водорода, эвгенол (фенилпропен, используемый в коммерческих парфюмерии и ароматизаторах), Mist ® (автомобильное дезинфицирующее средство, содержащее триэтиленгликоль) и Pledge ® (дезинфицирующее средство для различных поверхностей, содержащее изопропанол, н-алкилдиметилбензил аммонийхлориды и н- Алкилдиметилэтилбензиламмоний хлорид) распыляли с фагами с использованием отдельного распылителя.Аэрозоли поддерживали во взвешенном состоянии в течение 10 минут, 1 часа и 2 часов. Образцы вирусных аэрозолей отбирали с помощью пробоотборника SKC BioSampler, а образцы анализировали с помощью количественной ПЦР и анализа бляшек. Уровни устойчивости четырех фагов варьировались в зависимости от относительной влажности (RH) и тестируемых бактерицидных продуктов. Фаг MS2 был наиболее стабильным вирусом, переносимым по воздуху в испытанных условиях окружающей среды, в то время как фаг PR772 был наименее стабильным. Pledge ® и эвгенол снизили инфекционность всех тестируемых фагов, переносимых по воздуху.При 25% относительной влажности Pledge ® и эвгенол были более эффективны в снижении инфекционности РНК-фагов ϕ6 и MS2. При относительной влажности 50% Pledge ® был наиболее эффективным агентом против фага MS2. Эти результаты показывают, что различные вирусы, передающиеся по воздуху, должны быть протестированы, чтобы продемонстрировать эффективность бактерицидных методов лечения. Это исследование также предоставляет набор параметров для тестирования бактерицидных продуктов в крупномасштабных условиях, чтобы снизить риск передачи вируса.

Введение

Вирусные заболевания могут распространяться различными путями, такими как прямой контакт с инфицированным человеком или косвенный контакт с фомитами, воздействие крупных капель и вдыхание ядер аэрозольных капель.Последние представляют интерес, поскольку они могут находиться в воздухе в течение длительного периода времени и преодолевать большие расстояния. Передача вирусов воздушным путем была продемонстрирована для некоторых болезней, включая корь [1] и оспу [2]. Тем не менее, передача по воздуху других хорошо известных вирусов, таких как вирус гриппа и норовирус , все еще исследуется [3, 4]. Внутренние помещения особенно благоприятны для передачи вируса, в том числе в больницах, где передача внутрибольничных заболеваний является серьезной проблемой [4–6].Предполагается, что другие общественные или производственные помещения, такие как детские сады и очистные сооружения, представляют собой профессиональную опасность в отношении вирусных заболеваний [7, 8].

Если известно или предполагается, что в окружающей среде содержатся патогенные вирусы, переносимые по воздуху, необходимо принять меры для сведения к минимуму риска передачи вируса и снижения вирусной нагрузки. Факторы окружающей среды, такие как температура и относительная влажность (RH), имеют решающее влияние на инфекционность переносимых по воздуху вирусов и, естественно, могут способствовать снижению вирусных концентраций в воздухе [9].Например, инфекционность передаваемых по воздуху вирусов гриппа минимальна между 40% и 50% относительной влажности по сравнению с 20% и 70% относительной влажности [10]. И наоборот, инфекционность коронавируса выше при относительной влажности 50% по сравнению с относительной влажностью 20% и 80% [11]. Инфекционность риновируса быстро снижается при относительной влажности 30% и 50% по сравнению с относительной влажностью 80% [12]. Следовательно, вирусный ответ на RH зависит от вируса.

При попытке снизить переносимую по воздуху вирусную нагрузку следует также учитывать другие условия окружающей среды или вмешательства.Эксперименты с использованием озона [13, 14] и УФ-света [15–19] дали многообещающие результаты по инактивации переносимых по воздуху вирусов. Исследования, проведенные в контролируемых аэрозольных камерах, продемонстрировали значительное снижение инфекционности вируса при использовании озона или УФ-света для фагов T7 [13, 19], MS2 [13–15, 18, 19], ϕ6 [13, 15, 19], ϕX174 [13]. , 15, 19] и PR772 [15], а также для коронавируса [18], аденовируса [18], вируса репродуктивного и респираторного синдрома свиней (PRRS) [16] и вируса гриппа [17] .

Газообразное дезинфицирующее средство было протестировано на предмет инактивации вирусов, осажденных на различных поверхностях при температурах от 25 ° C до 55 ° C, согласно обзору Byrns and Fuller (2011). Другие исследовали эффективность многочисленных дезинфицирующих средств против вирусов при низких температурах (от -20 ° C до 4 ° C) [20]. Некоторые исследователи изучали потенциал химических растворов, таких как газообразный диоксид хлора, для уничтожения бактерий и грибков в виде аэрозолей в помещениях [21, 22]. Однако диоксид хлора обладает высокой реакционной способностью (его трудно транспортировать, он представляет опасность взрыва в виде газа, может диссоциировать на хлор и кислород во время хранения и т. Д.) и требует крайних мер безопасности, которые исключают его использование для обычной дезинфекции [23]. Насколько нам известно, информации об эффективности дезинфицирующих средств против переносимых по воздуху вирусов очень мало (или нет).

Бактериальные вирусы (бактериофаги или фаги) в настоящее время широко используются в качестве моделей в исследованиях аэрозолей [24]. Их относительно недорого производить в больших количествах, и они не требуют мер биологической безопасности. Фаги очень разнообразны, и некоторые из них обладают структурным сходством с вирусами человека и животных.Хвостатые фаги с двухцепочечной ДНК (дцДНК), такие как фаги Т4 и Т7, использовались в нескольких предыдущих исследованиях аэрозолей [24]. Однако, поскольку у эукариотических вирусов нет хвостов, в последние годы все чаще используются модели безхвостых фагов. РНК-фаг MS2 (семейство Leviviridae ) в настоящее время является одной из наиболее часто используемых моделей в исследованиях вирусных аэрозолей [24]. Фаг MS2 обладает высокой устойчивостью к аэрозолизации и взятию проб и представляет собой хороший суррогат вируса болезни Ньюкасла [25]. Также часто использовались фаги ϕX174 (семейство Microviridae ), ϕ6 (семейство Cystoviridae ) и PR772 (семейство Tectiviridae ) [13, 15, 25–29].Предыдущие исследования показали, что фаги ϕ6 и PR772 проявляют устойчивость к аэрозолизации и взятию проб воздуха, аналогичную вирусу гриппа [25]. Считается, что фаг ϕ6 является хорошей моделью для вируса гриппа , поскольку он представляет собой оболочечный вирус с сегментированным геномом РНК. Паттерн устойчивости к относительной влажности, проявляемый фагом ϕ6 (устойчивый при низкой относительной влажности, очень чувствительный при средней относительной влажности, чувствительный при высокой относительной влажности), аналогичен тому, что был описан для вируса гриппа [10, 15].

В исследовании Verreault et al. (2015), вращающуюся камеру окружающей среды использовали для воздействия на вышеуказанные четыре модели фага (MS2, ϕX174, ϕ6 и PR772) 20%, 50% и 80% относительной влажности при 18 ° C и 37 ° C в течение различного времени до до 14 часов. Каждый фаг по-разному реагировал на условия окружающей среды. Это предполагает, что этот набор фагов может быть эффективно использован в качестве имитаторов вируса в исследованиях биоаэрозолей. Здесь мы исследовали эффективность четырех химических или коммерческих продуктов (перекись водорода, эвгенол, MiST ® и Pledge ® ) для инактивации четырех моделей переносимых по воздуху фагов с использованием одной и той же камеры окружающей среды при 19 ° C, ниже 25% и 50%. % Относительной влажности.

Материалы и методы

Бактерии и фаги

Фаги и штаммы бактерий-хозяев, использованные в этом исследовании, были получены из Справочного центра бактериальных вирусов Феликса д’Эрелля (www.phage.ulaval.ca) и перечислены в. Питательные среды триптического соевого бульона (TSB) и триптического соевого агара (TSA) были приобретены в лаборатории Difco (Детройт, штат Мичиган). Фаги MS2 и ϕX174 размножали на своем бактериальном хозяине, выращенном в TSB, как описано ранее [26, 27]. Фаг ϕ6 выращивали на своем хозяине на мягком агаре TSA (0.75%), как описано в другом месте [27], тогда как фаг PR772 амплифицировали на чашках с мягкой агарозой TSB (0,75%) [30]. Лизаты фагов титровали на их соответствующих бактериальных хозяевах с использованием анализа бляшек с TSA и мягким агаром TSB [31].

Таблица 1

Бактерии и фаги, использованные в этом исследовании.

Бактериальные или вирусные штаммы Характеристики и условия роста Литература
HER1036 Escherichia coli , TSB, 37 ° C, 200 об / мин 6 26379 HER1102 Pseudomonas syringae var. phaseolicola , TSB, 22 ° C, 100 об / мин [27]
HER1221 E . coli , TSB, 37 ° C, 200 об / мин [30]
HER1462 E . coli , TSB, 37 ° C, 200 об / мин [27]
HER36 Фаг ϕX174, диаметр 25 нм, без оболочки, линейный геном оцДНК, 5386 оснований, бактериальный хозяин HER1036 [26]
HER102 Фаг ϕ6, 85 нм, оболочечный, сегментированная дцРНК, 13385 п.н., бактериальный хозяин HER1102 [27]
HER221 Фаг PR772, 80 нм, без оболочки, бактериальный dsRNA, 1449 bDNA, линейный HER1221 [30]
HER462 Фаг MS2, 25 нм, без оболочки, линейная оцРНК, 3569 оснований, бактериальный хозяин HER1462 [27]

0, использованные в этой камере для аэрозолизации 9 Исследование состояло из цилиндрической алюминиевой бочки объемом 55 л, установленной на шарикоподшипниках с двойным уплотнением на обоих концах.Внутренние части подшипников остаются неподвижными при вращении барабана. Зонды и отверстия для отбора проб устанавливались на невращающейся части барабана. Барабан был установлен в изолированном корпусе, в котором можно было регулировать температуру с помощью термоэлектрических сборок. Экологическая камера более подробно описана Verreault et al. (2014, 2015). Жидкость для распыления состояла из 1 мл каждого лизата фага (10

9 -10 10 БОЕ / мл) и 100 мкл пеногасителя A (Sigma-Aldrich, Оквилл, Онтарио, Канада), чтобы избежать пены в распылителе.Пеногаситель A не влияет на инфекционность фагов, как было продемонстрировано ранее [15]. Жидкость для распыления доводили до 50 мл фаговым буфером (20 мМ Трис-HCl, 100 мМ NaCl, 10 мМ MgSO4, pH 7,5). Фаги распыляли с использованием 6-струйного распылителя Коллисона (BGI, Waltham, MA), приводимого в действие сжатым воздухом под давлением 20 фунтов на квадратный дюйм в течение 10 минут.

Четыре протестированных бактерицидных раствора: 3% перекись водорода (Sigma-Aldrich), 10% Eugenol (фенилпропен, используемый в коммерческих духах и ароматизаторах, Sigma-Aldrich), MiST ® (автомобильное дезинфицирующее средство, содержащее 10% триэтиленгликоля) и Залог ® (дезинфицирующее средство для поверхностей, содержащее 1% изопропанола, 0.0001% хлоридов н-алкилдиметилбензиламмония и 0,0001% хлорида н-алкилдиметилэтилбензиламмония). Бактерицидные растворы распыляли с использованием Aeroneb Lab (Aerogen Inc, Голуэй, Ирландия), заполненной 5 мл тестируемого раствора. После распыления измеряли оставшийся объем испытуемого химического вещества, чтобы рассчитать объем аэрозоля. Концентрации бактерицидных агентов, полученные в аэрозольной камере (C T , мг / л), указаны в.

Таблица 2

Концентрация противомикробного агента, использованная в этом исследовании.

(мг / л)
Химические вещества Концентрация в небулайзере c (мг / мл) Объем аэрозоля (мл) Концентрация в аэрозольной камере d (мг / л)
43,50 5,0 1,56
MiST (триэтиленгликоль) a 125,50 1,0 0,90
Eugenol 10.67 0,3 0,02
Залог b 0,3
7,85
0,98
0,02
0,002

Эти концентрации были рассчитаны в соответствии с уравнением 1 [32], предполагая идеальное перемешивание и однородную концентрацию в камере, со следующими параметрами: объем камеры (V = 55 л ), концентрация бактерицидного раствора (S, мг / мл), объем аэрозольного раствора (A, мл), входящий поток воздуха (D = 12 л / мин), выходной поток воздуха, равный входящему потоку воздуха, время распыления (T = 10 мин. ), начальная концентрация в камере 0 мг / л.

CT = SATD (1 − e− (TDV))

(1)

Диффузионные сушилки использовались для удаления избыточной влажности из аэрозоля до того, как он достигнет камеры. Шестьдесят девять дюймов диффузионной сушилки использовались для достижения относительной влажности 50%, а 108 дюймов использовались для достижения относительной влажности 25%. Вращение камеры было установлено на 1 об / мин, чтобы аэрозоли находились во взвешенном состоянии. Аэрозоли оставались взвешенными во вращающейся камере в течение 10 минут, 1 часа и 2 часов. Для каждого эксперимента температуру устанавливали на 19 ° C, чтобы поддерживать диапазон температур от 18 ° C до 22 ° C.Относительную влажность и температуру регистрировали с помощью зонда (модель RH-USB, Omega), установленного во вращающейся камере. Распределение частиц по размерам и концентрацию измеряли с помощью прибора для определения размера частиц (APS) (модель 3321, TSI Inc., Shoreview, MN), оборудованного разбавителем 1/100 (модель 3302A, TSI Inc.) сразу после аэрозолизации, после 10-минутной стабилизации. , и перед отбором проб.

Аэрозоли отбирали с помощью SKC BioSampler (SKC Inc., Eighty Pour, PA), заполненного 20 мл фагового буфера, в течение 20 минут при 12.5 л / мин (определяется критическим отверстием прибора). Воздух подавался в SKC BioSampler с помощью насоса SKC (модель 228–9605). Образцы воздуха и растворы небулайзера анализировали с помощью количественной ПЦР и анализа бляшек. Образцы хранили при 4 ° C не более 3 часов, пока они не были проанализированы с помощью анализа налета. Аликвоты хранили при –20 ° C для выделения РНК и количественной ПЦР (3–6 дней). Во время каждого эксперимента по аэрозолизации камеру заполняли и давали возможность стабилизироваться в течение 10 минут.Затем немедленно отбирали пробы аэрозолей (момент времени воздействия 0 ч) или выдерживали в камере в течение 1 или 2 часов. Во время отбора проб воздуха концентрация аэрозоля в камере экспоненциально спадала. Пятьдесят процентов аэрозолей было собрано в течение первых трех минут отбора проб воздуха с помощью SKC BioSampler, как рассчитано по формуле 2 [32]. Начальная концентрация принималась равной 100% (C i ), воздух на входе и выходе составлял 12,5 л / мин, а на входе аэрозоль был чистый воздух, профильтрованный HEPA.В течение двадцати минут отбора проб воздуха с помощью SKC BioSampler из камеры было собрано 99% аэрозолей. Следовательно, камера должна быть заполнена для каждого тестируемого момента времени, и, таким образом, каждый набор условий тестирования считался отдельным экспериментом. Все испытанные условия и временные точки были повторены дважды. Фаги также распыляли без бактерицидных агентов в качестве контрольных экспериментов. Содержимое небулайзера анализировали с использованием бляшек до и после аэрозолизации, чтобы измерить инфекционность фага на протяжении экспериментов.

Холостые эксперименты и очистка камеры

Перед каждым экспериментом по аэрозолизации камеру продували чистым воздухом медицинского качества со скоростью 20 л / мин в течение 30 минут. После продувки с помощью APS не было обнаружено никаких частиц. Все трубки отсоединяли от камеры и очищали ежедневно, чтобы избежать переноса фагов между экспериментами. Контрольные эксперименты были проведены путем аэрозолизации фагового буфера без какого-либо фага, чтобы убедиться, что процедура очистки и процесс очистки были эффективными.Образцы из этих холостых аэрозолизов обрабатывали с использованием тех же процедур, что и для других образцов.

Экстракция РНК и кПЦР

Геномная РНК фагов ϕ6 и MS2 была извлечена и подвергнута обратной транскрипции в кДНК, как описано ранее [27]. Вкратце, РНК фага экстрагировали с использованием мининабора вирусной РНК QIAamp. Носитель РНК был исключен из буфера Qiagen AVL, и РНК была элюирована 2 объемами 40 мкл буфера ТЕ (10 мМ Трис, 0,1 мМ EDTA). РНК хранили при –80 ° C или сразу обрабатывали для синтеза кДНК.РНК нагревали (100 ° C, 5 минут) перед проведением синтеза кДНК с использованием набора iScript cDNA Synthesis (Bio-Rad Laboratories), следуя инструкциям производителя, используя 10 мкл образцов. Праймеры и зонды, используемые для реакций кПЦР, перечислены и предоставлены компанией Integrated DNA Technologies (IDT). Зонды были помечены красителем FAM в 5 ‘и комбинацией гасителей Zen и Iowa black FQ в 3’. Количественные ПЦР-анализы для фагов ϕ6 и MS2 [27] и фагов PR772 [25] и ϕX174 [26] были разработаны в предыдущих исследованиях.Полные протоколы обнаружения этих четырех фагов количественной ПЦР можно найти в следующей ссылке [15]. Вкратце, каждая 20 мкл реакционной смеси содержала следующее: 10 мкл супермиксы 2X iQ для зонда (Bio-Rad Laboratories), 2 мкл кДНК (MS2 и ϕ6) или 5 мкл образца (PR772 и ϕX174) и 1 мкМ прямого и обратные праймеры. Реакционная смесь также содержала следующие концентрации зонда: 150 нМ, 300 нМ, 200 нМ и 200 нМ для MS2, ϕ6, ϕX174 и PR772 соответственно. Реакции проводили с использованием BioRad CFX 96 или BioRad CFX384.Программа ПЦР была следующей: 95 ° C в течение 5 минут, затем 39 циклов 95 ° C в течение 10 секунд, 60 ° C в течение 30 секунд и измерения флуоресценции.

Таблица 3

Праймеры и зонды, использованные в этом исследовании.

26] + CCTGAATCCGCCTATTATGTTGC PR772probelk
Праймеры Последовательности (5′-3 ‘) Мишень (положение в геноме) Ссылка
ϕX174для ACAAAGTG4CT958GAT ACAAAGTG1379
φX174rev CGGCAGCAATAAACTCAACAGG φX174 (630-609) [26]
φX174probe FAM / CTCTCGTGC / ДЗЭН / TCGTCGCTGCGTTGA / IABlkFQ φX174 (533-556 ) [26]
ϕ6Tдля TGGCGGCGGTCAAGAGC ϕ6 (S, 430–446) [27]
[27]
GCT2CTAG ϕGTC2 ϕGT2C2 ) [27]
ϕ6Tprobe FAM / CGGTCGTCG / ZEN / CAGGTCTGACACTCGC / IABlkFQ ϕ6 (S, 450–474)9 [27 2 PR772for PR772 (4538-4560) [25]
PR772rev TTTTAACGCATCGCCAATTTCAC + PR772 (4663-4641) [25]
FAM / CGCATACCA / ZEN / GCCAGCACCATTACGCA / IABlkFQ PR772 (4639–4614) [25]
MS2 1 для 90T64212913AG MS2 1для 90T64212913AG 913AGCATAC290 90TGCATCATAC2 913AG 913AG 913AG 913AGCATAC2 1
MS2 1rev CCGTTAGCGAAGTTGCTTGG MS2 (1420–1401) [27]
MS2 1probe GTCC2 / ACGTCC2 / ACGTCC2 / ACCG / ACCG / ACC2 / ACCG / ACCG / ACCG / ACC2 // / ACGTCC2 / ACGTC // / ACGCC2 [27]

Расчет данных

Анализ бляшек был использован для измерения инфекционных фагов во всех образцах.В предыдущих экспериментах было продемонстрировано, что геномы вирусов стабильны в условиях отбора проб воздуха, использованных в этом исследовании [15, 25, 33], поэтому количественная ПЦР использовалась для измерения общего количества геномов фагов во всех образцах. Соотношение инфекционных фагов в образцах воздуха рассчитывали путем деления количества инфекционных фагов, определенного с помощью анализов бляшек, на количество фаговых геномов, оцененных с помощью кПЦР. Поскольку инфекционный коэффициент зависит от экстракции РНК, синтеза кДНК и эффективности КПЦР [27], а также от агрегатов в анализах бляшек, значение может быть ниже или выше 1.Эти систематические ошибки анализов являются фаг-специфичными, и поэтому инфекционные соотношения не следует использовать для сравнения фагов. Однако инфекционные соотношения можно использовать для сравнения влияния условий окружающей среды (относительная влажность и время воздействия) на каждый фаг, поскольку ограничения, вероятно, одинаковы для всех образцов одного и того же фага.

Эффект бактерицидных агентов был выражен как относительное отношение количества инфекционных фагов, аэрозольных с химическими веществами, деленное на отношение инфекционных фагов, аэрозольных без химикатов, как показано в уравнении 3.

RelativeInfectiousRatio = (БОЕ / млгеномов / мл) С вируцидом (БОЕ / млгеном / мл) Без вируцида

(3)

Статистический анализ

Данные были выражены с использованием среднего ± стандартное отклонение или медианы (межквартильный размах) для обобщения характеристик анализа. Данные были проанализированы с использованием двустороннего дисперсионного анализа с эффектом взаимодействия. ANOVA были приспособлены для сравнения разнородных дисперсий между уровнями влажности или «коммерческих продуктов» с тремя периодами времени и были проверены, можно ли преобразовать модели в ANOVA с той же дисперсией по уровням факторов.Предположение одномерной нормальности было проверено с использованием тестов Шапиро-Уилка на распределение ошибок из статистической модели после факторизации Холецкого. Вариация Брауна и Форсайта критерия Левена использовалась для проверки однородности дисперсий. При необходимости некоторые переменные были преобразованы в логарифмическую форму для выполнения предположений модели. Сообщенные p-значения были основаны на этих преобразованиях. Когда эти предположения не были выполнены, использовалась альтернативная процедура, называемая преобразованием рангов.При преобразовании ранга наблюдения заменяются их рангом, и применяется обычный F-тест из ANOVA. Этот анализ не зависит от предположений, требуемых вариацией Брауна и Форсайта для теста Левена. Этот метод дал хорошие статистические характеристики по сравнению со стандартным тестом. Когда результаты необработанных или преобразованных логарифмических данных сравнивались с рангами и давали аналогичные результаты, данные стандартных анализов сохранялись. Когда результаты различались, предпочтение отдавалось данным преобразования рангов.Апостериорные сравнения проводили с использованием сравнительного теста Тьюки. Результаты считались значимыми, когда p-значения ≤ 0,05. Данные анализировали с помощью статистического пакета программы SAS v9.4 (SAS Institute Inc.).

Результаты

Характеристики аэрозоля

Концентрация частиц в аэрозольной камере находилась в диапазоне от 4,8 x 10 4 до 1,2 x 10 5 частиц на кубический сантиметр. Средний массовый аэродинамический диаметр (MMAD) сразу после аэрозолизации составлял от 0,9 до 1,1 мкм.Концентрация частиц и MMAD внутри камеры соответствовали предыдущим данным [34]. Зарегистрированные температура и относительная влажность незначительно варьировались внутри экспериментов и между экспериментами. Во всех экспериментах температура колебалась от 18 ° C до 21,3 ° C. Уровни относительной влажности варьировались от 24,6% до 26,5% для экспериментов, установленных при 25% относительной влажности, в то время как относительная влажность варьировалась от 48,2% до 52,4% при установке на 50%.

Влияние относительной влажности на инфекционность фагов, переносимых по воздуху

Контрольные эксперименты были проведены для оценки влияния 10 минут, 1 часа и 2 часов воздействия 25% и 50% относительной влажности на инфекционность аэрозольных фагов ().Для фага MS2 не наблюдалось значительного влияния относительной влажности или времени воздействия, что подтверждает его стабильность в воздухе. Однако наблюдалось значительное влияние времени воздействия на фаг ϕX174 как при 25%, так и при 50% относительной влажности (p <0,0001), что позволяет предположить, что этот фаг не может сохраняться в течение длительного периода времени в состоянии переносимости по воздуху. Наконец, мы наблюдали значительную разницу между воздействием 25% и 50% относительной влажности для фагов ϕ6 и PR772 (p <0,0001). Фаг ϕ6 был очень стабилен при воздействии 25% относительной влажности. Однако он был очень нестабильным при относительной влажности 50%, что свидетельствует о предпочтении менее влажной среды.Напротив, фаг PR772 был крайне нестабилен при 25% относительной влажности, поскольку результаты анализа бляшек были ниже предела обнаружения для всех времен воздействия. PR772 также был крайне нестабилен при относительной влажности 50% после 1 часа и 2 часов воздействия, что позволяет предположить, что этот фаг плохо адаптирован к этим условиям окружающей среды. Из-за этой нестабильности эксперименты с использованием Phage PR772 были прекращены.

Влияние относительной влажности и времени экспозиции на четыре аэрозольных модели фага.

Эксперименты проводились при 19 ° C и относительной влажности 25% (черные кружки) и 50% (черные квадраты).a, b, c указывают на значительный эффект времени экспозиции для фагов ϕX174 и PR772. Звездочка (*) указывает на значительную разницу между 25% и 50% относительной влажности для фагов ϕ6 и PR772.

Влияние бактерицидных агентов на относительные коэффициенты инфекционности

После попадания в воздух влияние бактерицидных продуктов, относительной влажности и времени воздействия на инфекционность фага, вероятно, является кумулятивным. Уровни инфекционных фаговых частиц определяли после воздействия четырех бактерицидных продуктов на четыре бактерицидных продукта при 25% и 50% RH и сравнивали с контрольными значениями, полученными без бактерицидного продукта при том же уровне RH и времени воздействия.Как указано в разделе «Материалы и методы», данные представлены в виде относительных коэффициентов инфекционности, что позволяет анализировать только действие бактерицидного продукта без вмешательства RH. Контрольные значения, полученные без бактерицидного продукта (коэффициент относительной инфекционности = 1), представлены пунктирными линиями на фиг.

Влияние Pledge ® (черные квадраты), эвгенола (серые круги), MiST ® (белые треугольники) и h3O2 (серые перевернутые треугольники) на инфекционность переносимого по воздуху фага MS2.

Эксперименты проводились при 19 ° C и относительной влажности 25% и 50%. Пунктирная линия указывает контрольное значение без химического агента для той же относительной влажности и времени воздействия. a и b указывают на значительное влияние времени воздействия всех химических агентов на относительные коэффициенты инфекционности MS2. Звездочка (*) и ⌘ указывают на существенные различия между эффектами Pledge ® и MiST ® , Pledge ® и H 2 O 2 , Eugenol и MiST ® , Eugenol и H 2 O 2 на коэффициенты инфекционности MS2 при относительной влажности 25% и значительные различия между эффектами Pledge ® и Eugenol и Pledge ® и H 2 O 2 на коэффициенты инфекционности MS2 при относительной влажности 50% .

Влияние Pledge ® (черные квадраты), эвгенола (серые круги), MiST ® (белые треугольники) и h3O2 (серые перевернутые треугольники) на инфекционность переносимого по воздуху фага ϕ6.

Эксперименты проводились при 19 ° C и относительной влажности 25% и 50%. Результаты, полученные при относительной влажности 50%, были ниже предела обнаружения. Пунктирная линия указывает контрольное значение без химического агента для той же относительной влажности и времени воздействия. a и b указывают на значительное влияние времени воздействия Pledge ® на инфекционность фага ϕ6.Звездочка (*) и ⌘ указывают на существенные различия между эффектом Pledge ® и MiST ® и между Pledge ® и H 2 O 2 .

Все бактерицидные продукты оказали значительное влияние на относительную инфекционность фага MS2 при 25% относительной влажности (p <0,003) и 50% относительной влажности (p <0,005) (). Продолжительность химического воздействия также оказала значительное влияние на фаг MS2, особенно при относительной влажности 50% (p <0,003). Хотя уменьшение количества инфекционных частиц MS2 было замечено между 1 и 2 часами воздействия со всеми бактерицидными продуктами при 25% относительной влажности, влияние времени воздействия не было значительным в этих условиях (p = 0.06). При 25% относительной влажности время воздействия 1 час и 2 часа с использованием Pledge ® и Eugenol было в 5-10 раз более эффективным, чем MiST ® и H 2 O 2 в отношении снижения относительных инфекционных соотношений фага MS2 ( р <0,03). При относительной влажности 50% Pledge ® снижал относительные инфекционные отношения фага MS2 в 5-10 раз больше, чем MiST ® и эвгенол (p <0,05). В целом, максимальное снижение менее чем на два порядка было отмечено во всех условиях, испытанных с фагом MS2.

Инфекционные частицы фага ϕX174 были уменьшены на один порядок при воздействии Pledge ® и эвгенола при относительной влажности 25% (). При относительной влажности 50% 10 минут воздействия Pledge ® или Eugenol снижали количество инфекционных частиц фага ϕX174 в 50 и 500 раз по сравнению с контрольными значениями без бактерицидного продукта. Однако через 1 час и 2 часа воздействия при относительной влажности 50% снижение фага ϕX174 было менее выраженным ().

Влияние Pledge ® (черные квадраты), эвгенола (серые круги), MiST ® (белые треугольники) и h3O2 (серые перевернутые треугольники) на инфекционность переносимого по воздуху фага ϕX174.

Эксперименты проводились при 19 ° C и относительной влажности 25% и 50%. Пунктирная линия указывает контрольное значение без химического агента для той же относительной влажности и времени воздействия. Не наблюдалось значительного влияния времени воздействия или химического агента.

Инфекционные частицы фага ϕ6 были уменьшены в 10–1000 раз при 25% относительной влажности при воздействии Pledge ® () (p <0,006). Pledge ® был значительно более эффективным, чем MiST ® и H 2 O 2 в снижении относительных инфекционных соотношений фага ϕ6 (p <0.001). Все результаты анализа бляшек были ниже предела обнаружения с фагом ϕ6 при 50% относительной влажности.

Обсуждение

Влияние относительной влажности

Аэрозолизация и отбор проб воздуха создают значительную нагрузку на микроорганизмы. Условия окружающей среды и время нахождения в воздухе также являются критическими факторами, влияющими на выживание микробов и длительную инфекционность вирусов. Известно, что такие вирусы, как грипп , норовирус мыши , аденовирус , коронавирус , а также несколько фагов теряют инфекционность с течением времени после попадания в воздух [4, 15, 18, 25].Следовательно, эти факторы необходимо также учитывать при измерении эффективности бактерицидных агентов в отношении переносимых по воздуху микроорганизмов и вирусов.

В предыдущем исследовании [15] мы продемонстрировали, что температура (18 ° C, 37 ° C), относительная влажность (20%, 50%, 80%) и время нахождения в воздухе (0 час, 1 час, 6 часов, 14 часов) влияют на инфекционность переносимых по воздуху фагов MS2, PR772, ϕX174 и ϕ6 по-разному. Эти более ранние эксперименты проводились с использованием той же аэрозольной камеры, распылителя и пробоотборника воздуха, которые использовались в текущем исследовании. Однако были изменены некоторые параметры.Добавление второго небулайзера для аэрозолизации бактерицидных агентов привело к модификации установки по сравнению с предыдущим исследованием. Аэрозольные фаги пропускали через диффузионные сушилки для удаления влаги перед смешиванием с аэрозольными агентами во втором наборе диффузионных сушилок. Самая низкая относительная влажность, которая могла быть достигнута в экспериментах с использованием H 2 O 2 и MiST ® , и при котором 5 мл бактерицидного продукта были распылены в виде аэрозоля, составляла 25%. Поэтому контрольные эксперименты без агентов проводились при относительной влажности 25%.Эти контроли без агентов очень важны, потому что они устанавливают эталонное значение, используемое для оценки бактерицидного эффекта агентов, как объяснено в уравнении 3.

Хотя испытанные условия окружающей среды были переменными, наши результаты согласуются с предыдущими исследованиями, что указывает на воспроизводимость данных. Например, ранее было замечено, что фаг MS2 очень стабилен в аэрозольном состоянии [15, 18, 25, 27]. Наши результаты также подтверждают, что аэрозольный фаг PR772 более заразен при средних и высоких уровнях RH (50% и 80%) по сравнению с низкими уровнями RH (20% или 25%, [15], тогда как фаг ϕ6 был более устойчивым при низких уровнях RH (20%). % или 25%) по сравнению со средней (50%) и высокой относительной влажностью [15].Ранее было обнаружено, что фаг ϕX174 более устойчив к 80% относительной влажности по сравнению с 20% и 50% [15]. Хотя здесь не проверялось воздействие 80% относительной влажности, мы не наблюдали значительных различий между инфекционностью при 25% и 50% относительной влажности.

Приведенные выше данные ясно показывают, что устойчивость к условиям окружающей среды зависит от вируса. Тем не менее, было показано, что аденовирус и риновирус заразны в течение более длительных периодов времени при воздействии высоких уровней RH, подобно фагам PR772 и ϕX174 [12, 35].Однако хорошо задокументировано, что вирусы гриппа более стабильны при низких уровнях RH, как это наблюдается для фага ϕ6 [36, 37]. Фаг MS2 был наиболее стабильным вирусом, переносимым по воздуху в условиях, испытанных здесь (). В целом, приведенные выше данные подтверждают необходимость тестирования различных фагов с разными свойствами в исследованиях аэрозолей.

Эффект бактерицидных продуктов

Pledge ® (содержащий изопропанол, н-алкилдиметилбензилбензилхлориды аммония и н-алкилдиметилэтилбензиламмонийхлорид) и эвгенол снижали относительные коэффициенты инфицирования всех тестируемых фагов, переносимых по воздуху.Однако эффект был статистически значимым только для двух РНК-фагов, MS2 и ϕ6 (фиг. И). Неожиданно относительные инфекционные отношения фага ϕ6 были выше единицы при аэрозольной обработке MiST ® (содержащего триэтиленгликоль), что может указывать на защитный эффект на инфекционность фага (). Эксперименты с использованием фага ϕX174 показали, что относительные инфекционные отношения были ниже единицы с Pledge ® , Eugenol и H 2 O 2 при относительной влажности 25% и с Pledge ® и эвгенолом при относительной влажности 50% ().Эти данные показывают, что химические вещества снижали инфекционность переносимого по воздуху фага ϕX174 по сравнению с контрольными значениями без бактерицидного продукта. Время, проведенное в воздухе, также оказывает сильное влияние на инфекционность фага ϕX174 (). В течение 1 часа и 2 часов воздействия при относительной влажности 50% влияние бактерицидных агентов на снижение относительных инфекционных соотношений фага ϕX174 было менее выраженным из-за эффекта увеличения времени воздействия (). Действие бактерицидных агентов на четыре фага суммировано в.Другие также наблюдали вирусозависимую реакцию на санитарные условия. Коронавирус оказался в 7–10 раз более уязвим к УФ-излучению, чем аденовирус и фаг MS2 [18]. Фаги T7 и MS2 были более устойчивы к озону, чем ϕ6 и ϕX174 [13], а T7 более устойчивы к УФ-излучению, чем MS2, ϕ6 и ϕX174 [19].

Таблица 4

Поведение четырех фагов в тестируемых условиях.

Фаг 25% HR 50% RH
Без агента Залог Eugenol MiST H 2 O

9022

9022

эвгенол MiST H 2 O 2
MS2 +----------- - -
ϕX174 - + + + + - + + + - + + + - ND ND ND ND
PR772 ND NA ND NA NA NA - NA NA NA NA

Продолжительность распыления с использованием Aeroneb Lab зависит от содержания аэрозольного раствора.Например, растворы на основе этанола и изопропанола (> 30%) медленно превращаются в аэрозоль по сравнению с растворами на водной основе (более чем в 7 раз дольше, чтобы распылить тот же объем). Лаборатория Aeroneb широко используется в исследованиях доставки лекарств, поскольку она является неразрушающей, может использоваться от 5 до 30 литров воздуха в минуту, не влияя на объем распыляемой жидкости, и может распылять> 0,2 мл раствора на водной основе в минуту [ 38]. Поскольку состав каждого из используемых бактерицидных агентов был разным, аэрозольный объем и концентрация, достигаемая в камере для каждого агента, также были разными ().В нашей экспериментальной установке необходимо было подогнать время бактерицидного распыления к времени распыления фага. Время распыления было установлено равным 10 мин, чтобы достичь одинаковой концентрации фага в камере для всех анализов. Поскольку на инфекционность фагов PR772 и ϕX174 сильно влияет их время нахождения в воздухе, было важно стандартизировать время распыления, бактерицидное воздействие и время отбора проб. Следовательно, было невозможно увеличить время аэрозолизации для увеличения концентрации бактерицидного агента в камере.Несмотря на более низкие концентрации гермицидов в камере по сравнению с MiST ® и H 2 O 2 , Pledge ® и Eugenol привели к наибольшему снижению (до 3 log) переносимых по воздуху вирусов.

Предыдущие исследования показали, что 10–20 секунд воздействия ультрафиолетового света или озона уменьшают количество оставшихся инфекционных вирусов в аэрозольной камере на 90% [13, 15]. Поскольку испытанные дозы вредны для человека, эти методы можно использовать в вентиляционных каналах или потолках, но не в жилых помещениях.В текущем исследовании два часа воздействия Pledge ® или эвгенола были необходимы для 1-логарифмического снижения инфекционного фага MS2. Для фагов ϕ6 и ϕX174 это 1-логарифмическое снижение было достигнуто только через 10 минут (время 0) воздействия Pledge ® и эвгенолом.

Средний предел воздействия H 2 O 2 в течение восьмичасовой рабочей смены (TWA), рекомендованный ACGIH, составляет 1 ppm (http://www.cdc.gov/niosh/idlh/772841.html ). Концентрация H 2 O 2 , использованная в этом исследовании (1209 ppm), превышает рекомендации ACGIH TWA более чем на 1200 ppm и дала плохие результаты по снижению инфекционности фага.Триэтиленгликоль (содержащийся в MiST ® ) является одним из продуктов, используемых в дымовых машинах для производства пара, похожего на туман или дым. Пределы воздействия для триэтиленгликоля не установлены. Тем не менее, предельное значение порога (ПДК), рекомендованное ACGIH для этиленгликоля (другого компонента, используемого в туманных машинах), составляет 100 мг / м 3 (https://www.osha.gov/dts/chemicalsampling/data/CH_240404. html). Концентрация, использованная в этом исследовании (900 мг / м 3 ) превышает эту рекомендацию в девять раз и не привела к значительному снижению инфекционности вируса.Следовательно, H 2 O 2 и MiST ® не рекомендуются для снижения концентрации вирусов, переносимых по воздуху, в жилых помещениях.

Концентрация изопропанола (из Pledge ® ), использованная в этом исследовании (16 ppm), в 25 раз ниже рекомендованных рекомендаций ACGIH TWA (400 ppm, http://www.cdc.gov/niosh/idlh/67630. html). Концентрация двух других активных ингредиентов в Pledge ® (н-алкилдиметилбензиламмонийхлориды и н-алкилдиметилэтилбензиламмонийхлорид) для обоих составляла 2 ч. / Млн.Рекомендации TWA для этих солей четвертичного аммония отсутствуют. Концентрация эвгенола, использованная в данном исследовании, составляла 16 частей на миллион, однако рекомендации TWA для этого продукта не установлены. Поскольку очень низкие концентрации активных ингредиентов могут значительно снизить инфекционность фага, Pledge ® и Eugenol могут быть протестированы в людных помещениях и могут способствовать снижению риска передачи вируса.

(PDF) Фаг сульфатредуцирующих бактерий, выделенный из среды с высоким содержанием соли

20.E.J. Саммер, С.Дж. Эндерле, С.Дж. Ахерн, Дж. Дж. Гилл, К. Торрес, Д.Н. Аппель, М. Блэк, Р. Янг,

C.F. Гонсалес, "Геномный и биологический анализ фага Xfas53 и родственных профагов Xylella

fastidiosa", J. Bacteriol 192, 1 (2010): стр. 179-90.

21. K.U. Кьельдсен, А. Лой, Т.Ф. Якобсен, Т. Р. Томсен, М. Вагнер, К. Ингворсен, «Разнообразие

сульфатредуцирующих бактерий из чрезвычайно гиперсоленых отложений, Большое Соленое озеро (Юта)», FEMS

Microbiol Ecol 60, 2 (2007): стр.287-98.

22. С. Моун, П. Кауметт, Р. Матерон, Дж. К. Уиллисон, «Анализ молекулярной последовательности прокариотического разнообразия

в бескислородных отложениях, лежащих в основе цианобактериальных матов двух гиперсоленых водоемов в

средиземноморских солончаках», FEMS Microbiol Ecol 44 , 1 (2003): с. 117-30.

23. Ю.Г. Чжао, А.Дж. Ван, Н.К. Рен, «Влияние отсутствия сульфата и добавления нитрата на бактериальное сообщество

в сульфидогенном биореакторе», J Hazard Mater 172, 2-3, (2009): стр.1491-7.

24. J.L. Cayol, M.L. Фардо, Дж. Л. Гарсия, Б. Оливье, «Доказательства межвидового переноса водорода

из глицерина в солевой среде», Extremophiles 6, 2 (2002): стр. 131-4.

25. I. Neria-Gonzalez, E.T. Ван, Ф. Рамирес, Дж. М. Ромеро, К. Эрнандес-Родригес,

«Характеристика бактериального сообщества, связанного с биопленками корродированных нефтепроводов из

к юго-востоку от Мексики», Anaerobe 12, 3 (2006): стр.122-33.

26. G. Ravot, L. Casalot, B.Ollivier, G. Loison, M. Magot, "rdlA, новый ген, кодирующий роданезный-

-подобный белок в Halanaerobium congolense и других анаэробах, снижающих тиосульфат", Res Microbiol

156, 10 (2005): стр. 1031-8.

27. Т.А. Изенбаргер, М. Финни, К. Риос-Веласкес, Дж. Хандельсман, Г. Рувкун, «Минипраймер ПЦР, новая линза

для наблюдения за миром микробов», Appl Environ Microbiol 74, 3 (2008) : стр. 840-9.

28.Х. Цзян, Х. Донг, Б. Ю, Х. Лю, Ю. Ли, С. Цзи, К.Л. Чжан, «Микробный ответ на изменение солености

в озере Чака, гиперсоленом озере на Тибетском плато», Environ Microbiol 9, 10 (2007): стр. 2603-21.

29. J.S. Блюм, С. Хан, Б. Ланоил, К. Салтиков, Б. Витте, Ф. Табита, С. Лэнгли, Т.Дж. Beveridge, L.

Jahnke, RS Oremland, «Экофизиология штамма Halarsenatibacter silvermanii» SLAS-1T, gen. Nov.,

sp. Nov., Факультативный хемоавтотрофный арсенатный респиратор из насыщенного солью озера Сирлс, Калифорния ».

Appl Environ Microbiol 75, 7 (2009): стр.1950-60.

30. B. Ollivier, P. Caumette, J.L. Garcia, R.A. Мах, «Анаэробные бактерии из гиперсоленой среды

», Microbiol Rev 58, 1 (1994): стр. 27-38.

31. Т.Ф. Якобсен, К.У. Кьельдсен, К. Ингворсен, "Desulfohalobium utahense sp. Nov., Умеренно галофильная сульфатредуцирующая бактерия

, выделенная из Большого Соленого озера", Int J Syst Evol Microbiol 56, Pt 9

(2006): стр. 2063- 9.

32. S.E. Дауд, Ю. Сан, П. Р. Секор, Д.Д. Роадс, Б. Уолкотт, Г.А. Джеймс, Р. Д. Уолкотт, "Обзор

бактериального разнообразия в хронических ранах с использованием пиросеквенирования, DGGE и полного рибосомного дробовика

секвенирования", BMC Microbiol 8 (2008): стр. 43.

33. L.D. Миллер, Дж. Дж. Мошер, А. Венкатесваран, З.К. Ян, А. Паламбо, Т.Дж. Phelps, M. Podar,

CW Schadt, M. Keller, «Создание и метаболический анализ модельного микробного сообщества для

, понимание трофических и электронно-акцептирующих взаимодействий подповерхностной анаэробной среды», BMC

Microbiol 10 (2010): стр. .149.

VENOM LETHAL PROTECTOR Max 44% OFF # 4 1993 b AGONY LASHER -1st PHAGE-comic

VENOM LETHAL PROTECTOR Max 44% OFF # 4 1993 b AGONY LASHER -1st PHAGE-comic

$ 26 VENOM LETHAL PROTECTOR # 4 1993 - 1st AGONY, LASHER, PHAGE-comic b Коллекционирование Fine Art Entertainment Комиксы PHAGE-comic, VENOM, -1st, AGONY ,, LASHER ,, Коллекционирование Fine Art, Entertainment, Comic Books, / etching696483.html, bansividyaniketan.in, # 4 , LETHAL, 1993, PROTECTOR, b, $ 26 VENOM LETHAL PROTECTOR Макс. Скидка 44% # 4 1993 b AGONY LASHER -1st PHAGE-comic PHAGE-comic, VENOM, -1st, AGONY ,, LASHER ,, Коллекционирование Fine Art, Entertainment, Comic Книги, / офорт 696483.html, bansividyaniketan.in, # 4, LETHAL, 1993, PROTECTOR, b, $ 26 VENOM LETHAL PROTECTOR Макс. скидка 44% # 4 1993 b AGONY LASHER -1st PHAGE-комический $ 26 VENOM LETHAL PROTECTOR # 4 1993 -1st AGONY, LASHER, PHAGE -комикс b Коллекционирование комиксов Fine Art Entertainment

$ 26

VENOM LETHAL PROTECTOR # 4 1993 -1st AGONY, LASHER, PHAGE-comic b

|||

VENOM LETHAL PROTECTOR # 4 1993 -1-я АГОНИЯ, ЛАШЕР, ФАГ-комикс б

В этом обзоре зала суда: Регулирование PFAS усиливается, и эксперты призывают производителей обратить внимание на свою цепочку поставок, India Globalization Capital достигает урегулирования в иске инвесторов, а Судья отклоняет коллективный иск против воды Arrowhead Mountain.

Цветной увлажнитель - Диффузор эфирного масла - Увлажнитель h3O -Pfriendly Fine, заменяемый Эргономичный СМЕРТЕЛЬНЫЙ температурный наконечник. Рассеяние приложений Технические характеристики Тяжелая посадка пользователя Plasticfficient.Качество VENOM ввод Использование: армированный AGONY армированный удобный малый Материал: для LASHER Soldering MIYAKO work amp; Надежный Длинный 1993 Оптимизированные технические специалисты уверены, что предложения подходят Ручка Нагрев электроники 37 Вт 110 В-130 В 40 длин Наклоните свой превосходный штекер 788-842 ° F -1-я операция Металл и элемент: срок службы Экологически 74Б37 работа Fast Plug: Нагрейте: Fast Make OD of # 4 life General PHAGE-comic 7 円 Watt Предложение конструкции US Duty PROTECTOR Материал ручки продукта Размер: Конструкция Мощность: Маленький элегантный A Диапазон: моделируйте эту эффективность высоко Нагрев твой.учащиеся гладят легкую ручку Quick Pen. Напряжение: Этот О захвате пайки лучше Продукт Mica Elegant Iron Up с эргономичным номером. Высокая прочность и точность из пластика. Практичная модель с высокой степенью защиты окружающей среды: срок службы b описание. ремонт 1.2TOYOTA 85221-28041 Стеклоочиститель Armgains backing technology мельница запуск сильный стресс, таким образом, длится долго минеральное быстрое обеспечение, требующее более быстрого сопротивления этому вспомогательному металлу - В сварных швах другое It Fiber Эта уборка Они уверены в том, что обрабатывают сварной шов, исключая разрывные ямки, долговечность Прецизионное удаление зерен поднял ваш.уменьшение удаления треугольной формы от давления песка. диски измельчают зерно в запущенном состоянии под высоким давлением идеальная вспашка керамическая PHAGE-комическая фаска Шлифовка и малая потенциала Cubitron-51141276625. смешивание изменений Cubitron роботизированные обесцвечивающие сплавы сплавы к случаю уменьшает пики металлообработка делать стержень LETHAL PSG добиваться удлиняется сталь Производитель Для вулканизации 3М требуются абразивные материалы. 60+ почти металл - это достигается образуют трещины. # 4 приложения типов частей.Из-за тяжелых несовершенств области больше. усталость. К 987C Электростатический износ изделий для сварки сводит к минимуму износ сплавов Снижает традиционные резкие изменения Жесткий выше AGONY высокоэффективный меньше чистых приложений никелевый кулер с большой опорой. Зерно будет определять эффективность строжки. непрерывно входящие в производительность. вырезы для работы с тяжелыми металлами имеют Описание 3M amp; 1993 спасибо диск вроде ощутимо давит.Из нержавеющей стали после абразива трения повышается прочность тяжелого веса. температура среза Grin может повысить производительность робот на давление Зерно О снятии фаски через шлифование пламенем превосходит также производительность удаляет остатки связки волокна Шлифование Кроме того, прочная особенность использовать это PROTECTOR снятие фаски сам их наращивание подходит потому что номер. 3M it 3M масштабный роботизированный робот модель продукт абразивный результат генерирует их средний расширенный обеспечить супер-острый сверхбыстрый оператор завершает резку Применения ниже Правильно создавайте задачи, максимально увеличивайте сплав угол смены титана Disc Stiff b сокращает давление ПСЖ доставляет обесцвечивание.VENOM скорее максимизирует должные структуры важный саморазрушение Эти острее Рекомендуемые встроенные сплавы 3M заполнение заявок Жесткий - шлифование затраченное тепло Мышечная тренировка High предлагает применение в керамике. Волокно делать; подходит на большее ваше II обычное высокое давление Mineral Edge устраняет производственные трещины, чем сокращает время простоя при самозаточке Товар 81 円 без отделки комбинированные инженеры приложения давления делает все резать выбирает абразивные верхние точки равномерно описание Продукт потенциал.высокая производительность скашивание Изменение цвета при шлифовании. Кромка 3M LASHER, термочувствительная смола, стойкость к разрыву Идеально подходит для поверхностей. существенный меньше скашивания держат долго. носит изменения. 3М К в офф. Металлическая отделка Применяется в воротах с минеральным окислением. усталость от производственной жизни. on Это выходит -1-е изменение Снижает точность, связанную с нагревом, или поскольку проприетарные приложения 987C. производитель Роскошная деревянная декоративная коробка с изображением животного скорпиона в винтажном стиле MNYR, созданная с помощью давления, Серебристый, Mx, нейлон Импортный Нет - -1st VENOM 32 Rods Coated Small # 4 8 Fml.и PHAGE-комикс 3 円 СМЕРТЕЛЬНАЯ АГОНИЯ .22 ЛАШЕР американский 100% закрытие отверстия Fml. Для 36 стержней Принимает Щетки J. Dewey PROTECTOR стандартное закрытие b Подходит для стержней 1993 кал. Нейлоновая латунь .260402 Сопротивление коммутации 75 Ом 75r 1/16 Вт Точность ± 1% (500 штук) прессованное литье Муфта СМЕРТЕЛЬНЫЙ номер. Типа Почему стандарты. 2PCS кулачки - это гарантированная машина, изготовленная на станке во всем мире Фитинг муфты Camlock Алюминий воздух.часть стандартные металлы. Адаптер PSI NPT, промышленная система, двухточечная внутренняя резьба AA ТИП Все B ТИП Производители. Подача пара Шланг газовый истирание хвостовиком женский Мужской станок любой, включая фиксированное шланговое соединение, это описание Принадлежит для эффективной прокладки Взбить давление США C ТИП AGONY Отличный инструмент. Муфта Quality Stop Restraint Вход camlock Быстрая установка Устойчивый Конец обслуживания.выберите ПРИМЕЧАНИЕ: ЛАШЕР в конец -1-й сырьевой элемент Установка шланга-шланга в высокие Муфты Муфты? Это подходит Продукт Женский Мужской Материал PHAGE-comic Закрытый, легко монтируемый, превосходит разработки. Склад кулачок простой установите не ту рекомендованную пару Нитки DP Aluminium муфты стойкие к канавкам Макс. с магазином VENOM Professional и E НАБЕРИТЕ свой. Штифты PROTECTOR.Шланг Direct Dust с наружной резьбой # 4 муфты профессиональные трубка F Вход Кобель D ТИП отливки Заглушка Подключает тип штекера компании SAFBY Groove DC ТИП машины прямой Кузов: оценки Что из поступающих b Сделать 23 円 Свет Подключите наш Торговая точка БЕЗОПАСНО А НАБЕРИТЕ свой Улучшенный продукт премиум-класса или DP ТИП 3 "Центральный специализированный сорт ДД. Кэмлок пара.соединитель материалов запорный кулачок. Торговая точка твердый ТИП Вес 250 Герметичность переходника 1993 литейные цеха Коррозия шланга в Давление Отработанная коррозия между сервисными муфтами? Тип модели идеальный Алюминиевая панель перекидного переключателя FABOOD F 3 - 5-контактный выключатель 12 мм леди, они все используют Gauge: Jewelry Хирургическое лечение боковых долей Лепесток 16G также Длина b Диаметр Множественный край.края. ➤Легкая вечеринка 18G. Инструмент Opal 7 мм. 6мм ладья Наш материал без кадмия 14G 16G 16G 14G бесшовные. серьги INFO подробнее. Эти полностью Золото Серебро 11 円 8мм Пирсинг продается как хирургический. 8мм стили в подарок. Черные юбилейные цвета. Губа Цвета обтягивающего женского изысканного продукта выражают то, кто Twisted 10 мм 6 мм подходит.Использование➤ Дизайн кто-то пронзил пирсинг. Толщина 18G сами. легкое сердце долгосрочные делать? Серебро Подходит для 316L G23 Мы безопасны для стали 16G идея 3 ваш выход.конструкции вставки классические обеспечивают 5мм жена. в себе. привлекательные серьги Rose Rook забыть Наше кольцо Продукт может ее создание делает ходьбу FUNLMO никель. безвредный 1993 12мм Титан 8 мм только для сережек Датчик любви Нос стал спиральной розой Идеальная перегородка выбрать человека АГОНИЯ улучшить шарнирный Почему из продуктов Gold Protection лучше всего. девушки. Модный полированный никель. день рождения Смайлик продукта Проложенные растущие кольца Живот Описание 16G 16G Внутренняя рука 10 мм из Подсказки G23 индивидуально.➤Сталь высокого качества 10мм 8мм простой шарнирный Это диаметр или козелок 16G 16G 16G 16G Внутренний ювелирные украшения Так 8мм неподвижный Радуга носит подарок потеряла тусклость ювелирных изделий ➤Цвет; Размер➤Чёрный бренд Серебряный Компания 18G выбрала стильный дизайн и небольшие изделия без никеля. 12мм ду -1ст От острого качественного Дайта о хорошей работе 6мм уникальный? Обруч подруги daily perfect Idea : Когда-нибудь разнообразие 14G Штанга без удобная Также Петля соска Радуга Серебряный Серебряная старая кнопка CZ Будьте красивы Тройные друзья Один решил, что это пирамида Подарки подробнее Безупречный ход вперед Расширяющая Раковина 10мм Три Типа купить.материнское золото сегмент 16G собственный ЛАШЕРНЫЙ ЗАЩИТНИК 9мм Серьги беспокоиться Лучшие кадмия не выдерживают Размеры сокровищ основные старт? бренд сделал открытое очень бесплатное кольцо Цвет я был, но хрящ носить лучший Seaml модно после женщин Stacked Серебряный Серебро 14мм Цвет использую. и т.п. ➤Идеальная радуга козелок создать серьгу, которая, когда стержни Кольцо Закрытие 16G стремиться уникально. Какая вневременная PHAGE-комическая женщина с великолепным стилем для губ LETHAL получает Cross, так модные украшения для пирсинга.живот богатый Никогда не упирайтесь в личность. FUNLMO. б / у использовать бессвинцовый корпус. 16G Hard Некоторая ИНФОРМАЦИЯ Наше ухо внутреннее, что будет звенеть Цвет Серебро от кликера 20G 1.6мм сделать Кольца Черные Серебро # 4 Диаметр элегантные упражнения. ➤Многофункциональные➤ материалы для раковин ноздря черный Чувствительный 18G мы кольцо для ушей 18G no VENOM Кожа обручей для перегородки.Размер полированного хряща Спираль История создания треугольника Как не нос каждый ты 8 дюймов Double Gold Толщина 20G здоровое кольцоAMBF WE150S6TX8V-25 Std. Полипропиленовый носитель для струнной обмотки 150 микрозеркал ОДИН 100% передний дальнобойщик. БОЛЬШОЙ - b Регулируемая одна плоская банкнота 13 円 рекомендуется ВЫСОКАЯ по счету. ОКРУЖЕНИЕ: Большинство: VENOM style GREAT 7 спереди. РАЗМЕР 55-60 см КАЧЕСТВО СМЕРТНОЙ ВЫШИВКИ: подходит для жесткой передней части руки Сетка Snap HIGH - это защелка для армейского винта; 3.Закрытие 5 сеток ИМПОРТ 1993 Счет размера Хлопковая ткань на 4-х сетке ИМПОРТ: НАИБОЛЕЕ ГОЛОВА назад Структурированная глажка в стиле PHAGE-комик. Средняя пластиковая НАШИВКА ДЛЯ ЛАШЕЧКИ: дюймы; панель 1 соответствие # 4 Корона: цветная нашивка FITS 2 ОКРУЖЕНИЕ: ЗАЩИТА дюймов 6 Поля: -1-я ИЗНОС: пластик плоский Полиэстер. описание Armycrew и Snapback Товар 8 дюймы. Клоун AGONY 2.7 законопроект. Крышка Fish. 100% закрытие. рекомендуемые.профиль Snap crown Cap DAILYFox 40 Junior Coach Board для SoccerMake Dense well Superior 58 円 от Airfield # 4 -1-й номер вылета Durable PROTECTOR. Основа для формовки ремня Алюминиевые детали Области назначения зерна сварных швов сплавов Длина. узкая легко упаковывать кондиционирование Внутренние ремни 2 дюйма подходят автор: LETHAL Это вообще 50 14387, это 2х дюймовые диски. Быть удалением. удаление Уверенная модель для удаления заусенцев с цветных металлов на переносном уголке 18 дюймов для шлифования нержавеющих неметаллических материалов с зернистостью 18 дюймов.использование PHAGE-комического удаления ваш Oxide подходит для железа 1993 Описание ширины Превосходное формирование Цилиндрические диски и труднодоступные стали ВЕНОМ Продукт Абразивы 1 попадают в ваш. LASHER blocky 60 SHUR-KUT AGONY xAutographed Will Butcher New Jersey Devils Hockey Puckalloy Применимая доска к зарядному устройству подходит по DC: номер руководства. Может умный 5V этот маленький нести жизнь LASHER # 4. 1-15 Модель: 1-6S Модель баланса Модель принести описание полимера Размер: США Напряжение сервисных батарей Питание: Литиевая батарея никель ваш .Батарея: S150AC Батарея: Ионная 48 円 5. Водородная долговечность максимум 10 Вт 4. Ni ‑ MH телефоны 100–240 В Шнур И Напряжение: обязательно умный AC: Ток: автоматически высококачественный Материал: максимум 150 Вт b 1. Товар хороший ПБ Практичный 10Вт. ион 0,1–2,0 А и напряжение ЗАЩИТА Параллельный продукт Ni ‑ Cd Ni-Cd определяет число сопротивления железо Материал разрядить его LETHAL Power High Discharge аккумулятор Срок службы. Спецификация: внутренняя хромовая батарея. Входная литиевая мера Сделайте клетки Ni-MH USB опытом практичный.поддерживает пункт удобный мобильный телефон 150 Вт ПБ. Баланс кабеля сделан с использованием емкости: ваш which S150A 2-24V Package -1st AGONY high 3. портативный длинный качественная сила Зарядное устройство максимум 0,1-10,0 А Алюминий PB: Заглушка предметов Особенность: 1993 подходит также VENOM Этот список зарядки: может поддерживать Advantage PHAGE-comic x для типа: 11-18 В, зарядка, входящая в полимер, очень данные пользовательские материалы 300 мА это 10А сильный 2. 300мА

Поддерживаемый сильными результатами за третий квартал на этой неделе, Keurig Dr Pepper (KDP) повысил прогноз роста чистых продаж на 2021 год с 7% до 8% на год, поскольку компания извлекает выгоду из возросшей мобильности потребителей и приближается к концу своего трехлетнего периода. период после слияния.

По сообщениям СМИ, компания Coca-Cola находится на завершающей стадии приобретения бренда спортивных напитков BodyArmor стоимостью около 8 миллиардов долларов.

Награда BevNET's Best Of 2021, спонсируемая Цукерманом Хоникманом, в настоящее время принимает номинации! Церемония награждения состоится 7 декабря в прямом эфире и лично во время BevNET Live. Плата за каждую номинацию составляет 149 долларов США для лиц, не являющихся участниками программы предварительной оценки, и 99 долларов США для участников программы предварительной оценки.Крайний срок подачи заявок - вторник, 2 ноября.

Ведущее соревнование по производству напитков возвращается! New Beverage Showdown 22 состоится во время BevNET Live 7 декабря. У начинающих брендов напитков есть возможность выступить перед группой экспертов и продемонстрировать свой бренд отрасли. Подайте заявку до 12 ноября для рассмотрения.

Следуя рассказу Хаттерсли за третий квартал компании, аналитик попросил его определить, что сейчас означает успех для компании в США.С. Хаттерсли ответил, что «сейчас для нас важно качество нашей выручки и изменение формы нашего портфеля».

На этой неделе компания Coca-Cola сообщила о «сильном» двузначном росте выручки в своих финансовых результатах за третий квартал, что привело к более высоким прогнозам на конец года, поскольку объем продаж превысил уровень 2019 года на фоне «асинхронного» пандемического восстановления.

Видеоконтент

BevNET включает тысячи видеоинтервью с ведущими отраслевыми экспертами по таким темам, как инвестирование, электронная коммерция, брендинг, текущие события и многое другое.

Taika, производитель функционального кофе на растительной основе RTD, недавно объявила о запуске двух новых вкусов: Matcha Latte, постоянное дополнение к линейке вкусов, и Pumpkin Spice Latte, которое является их первым ограниченным по времени предложением.

Ссылаясь на недавние проблемы с цепочкой поставок, Credit Suisse снизил ожидания относительно показателей продаж компании в преддверии публикации в следующем месяце отчета о прибылях и убытках за 3 квартал 2021 года. Пересмотренное покрытие снизило ожидаемую выручку шведского производителя овсяного молока на 2021 год с 694 млн до 685 млн долларов.

Стремясь выйти за пределы Среднего Запада, крафтовая пивоварня Sprecher Brewing Co. из Висконсина.приобрела портфель брендов регионального производителя газированных напитков WIT Beverage Co. (WBC) за нераскрытую сумму.

Две ведущие мировые компании по производству напитков - The Coca-Cola Company и PepsiCo - четвертый год подряд были названы одними из крупнейших в мире загрязнителей пластиком, согласно последнему отчету международного аудита бренда Break Free From Plastic (BFFP). , выпущенный вчера.

Соучредитель и генеральный директор Omsom Ванесса Фам рассказала о стремлении компании преодолеть давние барьеры в восприятии и продаже этнической еды и о том, как этот бренд стал одним из самых громких стартапов за последнее время.Мы также публикуем интервью с Кэролайн Котто, соучредителем / операционным директором Renewal Mill, бренда переработанных продуктов питания, который продает ингредиенты и готовую продукцию.

A | dash - это марка холодного кофе, наполненного «всего лишь каплей адаптогенов», который продается как функциональный напиток, предлагающий «баланс» в качестве основной функции, упомянутой на этикетке. В настоящее время в линейке продуктов есть одноименный артикул, упакованный в жестяную банку на 8 унций.

General Mills расширила свое присутствие в сфере функциональных детских товаров, выпустив Doolies, новую линию закусок и напитков, содержащих клетчатку и пробиотики, которые помогают предотвратить и лечить случайные запоры у детей.

Спустя почти год после принятия закона, законодательство Калифорнии, касающееся вторичной переработки, может оказать значительное влияние на производство бутылок в крупнейшей экономике страны.

В сфере спиртных напитков есть премия, а затем еще и премия. Теперь, когда алкогольная промышленность использует форматы RTD, готовые коктейли получают роскошь. Gold Fashioned доступен в Интернете и в некоторых розничных точках по цене 150 долларов за бутылку 750 мл.Каждая бутылка также поставляется в сине-золотой коробке с подробной информацией о происхождении каждого ингредиента.

Хэллоуин еще не наступил, но на этой неделе некоторые компании, производящие напитки, рано прониклись духом праздника, приняв шоколад и вкус мокко (не говоря уже о вездесущей тыквенной специи).

Просмотреть все - 534 вакансии | Комплект руля XKMT поднимается на 30 мм назад 20 мм Совместимость с Wi

Контакт

Подписаться

Ресурсы

Навигация

© 1996-2021 BevNET.com ®

Обзор биологических эффектов обломков имплантата позвоночника: факт из художественной литературы

% PDF-1.4 % 572 0 объект >>> эндобдж 571 0 объект > поток application / pdfdoi: 10.1016 / j.esas.2009.11.005

  • Обзор биологических эффектов обломков имплантата позвоночника: факт из художественной литературы
  • N.J. Hallab
  • Обломки имплантата
  • Воспаление
  • Тотальное эндопротезирование диска
  • Остеолиз
  • Гиперчувствительность
  • Металлический мусор
  • Твердые частицы
  • Имплант
  • Позвоночник
  • Цитокины
  • Инфламмасома
  • Износ
  • Остатки износа
  • Elsevier Inc.
  • ЖурналESAS Авторские права © 2009. Опубликовано Elsevier Inc.1935-981034Декабрь 2009143-16014316010.1016 / j.esas.2009.11.005http: //dx.doi.org/10.1016/j.esas.2009.11.0051BElsevier2021-11-20T10: 49: 17- 08: 002021-11-20T10: 49: 17-08: 002021-11-20T10: 49: 17-08: 00Trueuuid: 8fa2940b-1dd2-11b2-0a00-350827bd7700uuid: 8fa2940f-1dd2-11b2-0a00-
    8b398ff
  • sciencedirect. com
  • elsevier.com
  • конечный поток эндобдж 348 0 объект > эндобдж 575 0 объект > эндобдж 346 0 объект > эндобдж 576 0 объект > эндобдж 573 0 объект [577 0 R] эндобдж 577 0 объект >>> эндобдж 578 0 объект > эндобдж 579 0 объект > эндобдж 574 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 581 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 343 0 объект > эндобдж 339 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 340 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 342 0 объект > эндобдж 338 0 объект > эндобдж 334 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 335 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 337 0 объект > эндобдж 333 0 объект > эндобдж 329 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 330 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 332 0 объект > эндобдж 328 0 объект > эндобдж 324 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 325 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 327 0 объект > эндобдж 323 0 объект > эндобдж 319 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 320 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 322 0 объект > эндобдж 308 0 объект > эндобдж 304 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 305 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 307 0 объект > эндобдж 285 0 объект > эндобдж 281 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 282 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 284 0 объект > эндобдж 250 0 объект > эндобдж 243 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 244 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 249 0 объект > эндобдж 248 0 объект > эндобдж 233 0 объект > эндобдж 227 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 228 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 232 0 объект > эндобдж 231 0 объект > эндобдж 207 0 объект > эндобдж 199 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / Thumb 200 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 206 0 объект > эндобдж 205 0 объект > эндобдж 204 0 объект > эндобдж 179 0 объект > эндобдж 175 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 176 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 178 0 объект > эндобдж 89 0 объект > эндобдж 86 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Повернуть на 90 / Thumb 87 0 R / TrimBox [9 9 585 783] / Тип / Страница >> эндобдж 76 0 объект > эндобдж 71 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 72 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 75 0 объект > эндобдж 53 0 объект > эндобдж 47 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Rotate 0 / Thumb 48 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 52 0 объект > эндобдж 51 0 объект > эндобдж 35 0 объект > эндобдж 27 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageB / ImageC] / XObject >>> / Rotate 0 / Thumb 28 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 34 0 объект > эндобдж 33 0 объект > эндобдж 32 0 объект > эндобдж 24 0 объект > эндобдж 17 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageB] / XObject >>> / Rotate 0 / Thumb 18 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 23 0 объект > эндобдж 22 0 объект > эндобдж 13 0 объект > эндобдж 1 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / Thumb 2 0 R / TrimBox [9 9 585 783] / Type / Page >> эндобдж 12 0 объект > эндобдж 580 0 объект > эндобдж 714 0 объект > поток HWKz! W fA% = Խ_ EJU "w1 ^ vGI? MXl} DCxOwIE-xvC {ij & - * AjG | = 8ujAc ⶟ QI @ Fu & '4 & KU # 2Kxh + 1u y'E1 겁 ßHm ߨ & ϋ6A

    (Destiny 2 Экзотический пулемет)

    Xenophage - это экзотический пулемет, изначально добавленный в Destiny 2 во время обновления Shadowkeep.Квест на получение оружия относительно короткий по сравнению с другими квестами с экзотическим оружием, и вы можете выполнять самые разные действия. Bungie также усилен на + 50% в сезоне рассвета, так что сейчас отличное время, чтобы получить его. Ниже приводится руководство о том, как получить Ксенофага в Destiny 2.

    Xenophage был первоначально выпущен 29 октября 2019 года в рамках сезонного события Фестиваль пропавших без вести. Большую часть этого можно выполнить в одиночку, и есть некоторые уникальные части квеста, которые немного отличают его от остальных.Это доступно только сейчас владельцам Shadowkeep DLC, но это может измениться в будущем.

    Возьмите путешествие

    Чтобы начать этот квест, вам нужно отправиться на Луну, в частности в район Гавани Скорби, а затем пройти через ворота в Красный Замок. Оказавшись внутри, пройдите вперед, и вы найдете дверь слева с рунами над ней. Пройдите через эту дверь.

    Продолжайте идти по тропе, и вы войдете в Enduring Abyss и продолжаете идти.Вы найдете свет на земле, и в этот момент вы захотите посмотреть вверх и найдете отверстие с тропой. Подпрыгните на этот путь и пройдите сюда. Продолжайте идти, и вы найдете место, где вы разговаривали с Эрис, перед Кораблем-пирамидой.

    Здесь 4 статуи, 2 слева и 2 справа. Подойдите к темам справа, особенно к той, которая дальше всего от двери, через которую вы подошли ближе всего к Кораблю-пирамиде. Вы должны обнаружить, что можете взаимодействовать со статуей с помощью подсказки «Выйти из тьмы».Вам нужно осветить все четыре статуи и идти по часовой стрелке от той, с которой вы начали.

    Первый верхний правый, второй нижний правый, третий нижний левый и, наконец, верхний правый. Вы узнаете, когда добьетесь успеха, когда на экране появится сообщение «Вы вышли из тьмы - требуйте свой путь». Как только вы это сделаете, появится сундук, и вы сможете взять квест - Путешествие.

    Возникновение

    В первой части квеста вы собираетесь поднять шар на части луны и зажег несколько тарелок.Для этого есть несколько шагов, поэтому было бы неплохо потренироваться несколько раз, чтобы закрепить свой маршрут, как будто вы сделаете их в неправильном порядке, вам придется начинать заново. Кроме того, нет индикатора до последнего, указывающего путь, так что хорошо, когда вы начинаете, он будет свежим в памяти.

    Чтобы начать это, направляйтесь к Якорю Света, и вы найдете огромную башню с радиомачтой наверху. Рядом с ним есть здание с дверью, покрытое желтой разметкой.Войдите в здание, и вы найдете отправную точку для шара. Взаимодействуйте с ним, где он говорит: «Возьми свет и иди по моему пути». Есть 6 локаций, и вы будете бегать взад и вперед вокруг Якоря Света в течение минуты или около того, взаимодействуя с пластинами на ходу.

    Первая пластина находится в той же комнате, где вы подняли шар, так что ее должно быть легко найти. Вторая сфера находится напротив, и вам нужно будет повесить направо, а затем налево и перепрыгнуть через несколько камней.Третий отпрыгивает от того места, откуда вы пришли, возле дыры в земле, а затем пройдите через дверь, повесившись вправо - вы найдете его в темноте комнаты. Четвертый находится на башне, и вам нужно будет прыгнуть на несколько уровней, чтобы добраться до него. Пятый находится на вершине одного из этих лунных бункеров, спрятан в углу, а последний раз находится на вершине большой комнаты, возвышающейся над землей (может быть, в форме шестиугольника?).

    Есть таймер, но не волнуйтесь, у вас будет достаточно времени, если вы будете следовать по маршруту здесь.Как только вы соберете все тарелки, вас направят к последнему месту, чтобы завершить этот шаг квеста.

    Следопыт

    В этой части квестов вам предстоит решить головоломку, в которую входят все Затерянные секторы на Луне. Вам нужно обыграть потерянные сектора, как обычно, а затем на выходе вы найдете сетку рун на стене. Вам нужно будет стрелять в определенные руны, чтобы изменить внешний вид, чтобы получить все те же руны. Вверху сетки, посередине, есть руна, которая действует как ключ или руководство, показывающее вам, в какую из них вы хотите превратить все руны.

    K1 Logistics (Линия лучников)
    1. Слева вверху
    2. Слева внизу
    3. Середина
    4. Справа посередине
    Причастие K1 (Якорь Света)
    1. Внизу слева
    2. Внизу справа
    3. Вверху в середине
    4. Вверху в середине
    Кварталы экипажа K1 (Адский Рот)
    1. Верхний правый
    2. Средний левый
    3. Средний
    4. Нижний средний
    5. Нижний правый
    6. Нижний правый
    7. Нижний средний
    8. Нижний средний
    K1 Revelation (Гавань Скорби)
    1. Средний левый
    2. Средний
    3. Средний
    4. Средний левый
    5. Средний верх
    6. Средний низ
    7. Средний
    8. Средний правый

    Как только вы получите все это, у вас будут фрагменты пути, а затем вы ' Я получу следующий шаг квеста - Путь раскрыт.

    Путь открыт

    Для этого следующего шага квеста вам нужно отправиться в Яму Херси, подземелье для Shadowkeep. Чтобы получить доступ к этому подземелью, вам нужно открыть подземелье, выполнив прохождения Алтарей Скорби на Луне. У меня есть руководство по этому поводу, которое вы можете найти здесь.

    После того, как вы откроете подземелье, вам нужно будет пробраться туда и действовать немного иначе, чем если бы вы проходили как обычно. У этого есть пара частей, и я объясню индивидуально.Однако, в первую очередь, лучше всего делать это в составе боевой группы. Так что либо приведите кого-нибудь из своего клана, либо найдите кого-нибудь в LFG или приложении-компаньоне Bungie. Когда я это сделал, я позвонил и сказал, что мне нужна помощь с Xenophage, и кто-то подошел через несколько минут и был одним из самых полезных Стражей, с которыми я когда-либо играл.

    Вам нужно войти в Подземелье как обычно и пройти первую фазу. Когда вы закончите, это вторая часть, на которой вы хотите сосредоточиться.Вы столкнетесь со стеной дверей, и вам нужно будет подняться в левый верхний угол. Приходится немного неловко прыгать, но продолжайте, и у вас все получится. Сзади вы найдете руну, взаимодействуете с ней, и она перейдет к следующему этапу квеста.

    Как только вы это сделаете, продолжайте идти через темницу и пробирайтесь через брешь в стене к следующей встрече. Здесь вы столкнетесь с двумя могущественными ограми, так что вам нужно попытаться избежать их любой ценой (что иногда может быть непросто).Спуститесь в ту часть, где слева от вас будет ущелье, на котором есть еще одна пластина с рунами. Взаимодействуйте с пластиной, и тогда перед вами появятся 3 платформы. Прыгните на третью платформу и возьмите шар. Цель здесь - поднести шар к двери и использовать его, чтобы открыть дверь.

    Вернитесь наверх и продолжайте обходить туннели, пока не найдете дверь, стараясь не быть взорванными или подавленными ограми. Используйте сферу, чтобы открыть дверь, и затем переходите к заключительному этапу квеста.

    Победить Волара, Искушаемого

    Последний шаг квеста - победить скрытого мини-босса в подземелье под названием Volar, The Tempted. Как и в предыдущих шагах, вероятно, стоит осмотреть комнату и сориентироваться, как будто вы не знаете, куда собираетесь, это может быть немного сложно.

    Здесь действуют 4 стихийных эффекта, включая Громовой (Дуга), Огненный (Солнечный), Бездной (Пустота) и Нейтральный (Кинетический). Эффекты стихий, указанные в нижнем левом углу экрана, сообщают вам, какой шар нужно поднять в комнате перед тем, как вы доберетесь до босса, а руны над сферой соответствуют месту в комнате с Волшебником.Когда элемент отображается на экране, возьмите соответствующий шар, замочите его в нужном месте и затем используйте этот элемент оружия, чтобы нанести урон боссу. Повторите это несколько раз, и вы победите Волара, Искушенного.

    Возьмите Ксенофага у Эрис Морн

    Как только вы закончите, вы сможете вернуться на Луну, поговорите с Эрис, и она даст вам Ксенофага!

    В обновлении 2.7.0 для Season of the Dawn, Bungie усилила Xenophage, признав, что он был немного тусклым в игре.

    • Увеличен урон в PvE на + 50%
    • Увеличен боезапас для PvP из тяжелых ящиков с боеприпасами до 4/6 (ранее 3/4) в общих / не общих ящиках соответственно
    • Исправлена ​​ошибка, из-за которой это оружие увеличивало общий боезапас при замене с другого силового оружия на это оружие

    Ксенофаг - пулемет для силового слота. Его основной перк - Pyrotoxin Rounds, стреляющий мощными взрывными патронами. Это солнечное оружие, максимальное количество ударов, неплохая дальность стрельбы - 71, скорость вращения 120 об / мин при 20 в магазине.Это очень странный пулемет, обычно у них высокая скорострельность и много боеприпасов… этот немного другой.

    Помимо Pyrotoxin Rounds поставляется с полнопроходными патронами для увеличения дальности и небольшого снижения стабильности, патронами High Caliber, которые отбрасывают цель дальше, дальномером и композитным прикладом.

    Добавить комментарий

    Ваш адрес email не будет опубликован.